Incidental Mutation 'R6392:Tagap'
ID515831
Institutional Source Beutler Lab
Gene Symbol Tagap
Ensembl Gene ENSMUSG00000033450
Gene NameT cell activation Rho GTPase activating protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R6392 (G1)
Quality Score146.008
Status Not validated
Chromosome17
Chromosomal Location7926000-7934897 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7934061 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 693 (G693W)
Ref Sequence ENSEMBL: ENSMUSP00000047431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036370]
Predicted Effect probably damaging
Transcript: ENSMUST00000036370
AA Change: G693W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047431
Gene: ENSMUSG00000033450
AA Change: G693W

DomainStartEndE-ValueType
RhoGAP 98 274 1.16e-35 SMART
low complexity region 350 361 N/A INTRINSIC
low complexity region 459 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160545
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase-activator protein superfamily. The encoded protein may function as a Rho GTPase-activating protein. Alterations in this gene may be associated with several diseases, including rheumatoid arthritis, celiac disease, and multiple sclerosis. Alternate splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T C 6: 41,032,372 Y176C probably damaging Het
Aars2 A T 17: 45,514,600 I330F probably damaging Het
Abcc9 A G 6: 142,682,099 S402P probably damaging Het
Ada A G 2: 163,728,217 L292P probably damaging Het
Adra1d T C 2: 131,561,609 D187G probably damaging Het
AI467606 C A 7: 127,092,545 Y97* probably null Het
Arid2 A G 15: 96,361,602 E245G probably damaging Het
Ccdc78 C G 17: 25,788,174 Q213E probably damaging Het
Cntnap1 G T 11: 101,186,646 D1045Y probably damaging Het
Ctcf T C 8: 105,664,133 V124A probably damaging Het
Cutc T C 19: 43,760,050 S129P possibly damaging Het
Dhx36 T C 3: 62,494,369 I308V probably benign Het
Disp2 T C 2: 118,790,749 V654A probably damaging Het
Esm1 G A 13: 113,209,749 probably benign Het
Extl1 C T 4: 134,364,634 V303I probably benign Het
Ezh1 G T 11: 101,203,804 D387E probably damaging Het
Fbf1 T A 11: 116,152,949 probably null Het
Fbxl12 T C 9: 20,639,176 H84R probably damaging Het
Fbxo6 C T 4: 148,146,005 V267I probably benign Het
Gm5346 A T 8: 43,626,001 N395K probably benign Het
Helz G T 11: 107,602,341 A197S possibly damaging Het
Ikbke T C 1: 131,275,146 probably null Het
Kbtbd13 A G 9: 65,390,337 F439S possibly damaging Het
Kif7 G A 7: 79,702,186 R943W probably damaging Het
Lrp12 C T 15: 39,872,019 C839Y probably damaging Het
Matr3 A G 18: 35,584,841 D364G probably benign Het
Ncam1 T C 9: 49,523,575 K624E probably damaging Het
Nup205 T C 6: 35,189,885 S280P possibly damaging Het
Olfr1196 A T 2: 88,700,667 Y221N probably damaging Het
Olfr622 A C 7: 103,639,682 C153G probably benign Het
Pira2 A T 7: 3,843,902 S214T possibly damaging Het
Ptpn4 T A 1: 119,773,123 I30F probably benign Het
Rnf144a T C 12: 26,310,780 I253V possibly damaging Het
Sh3pxd2b T A 11: 32,423,302 L823Q possibly damaging Het
Sh3rf3 A T 10: 59,007,076 D288V probably damaging Het
Shprh T A 10: 11,178,741 Y1031* probably null Het
Sidt1 T C 16: 44,291,294 T173A possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Ssh3 C T 19: 4,265,371 R309H probably benign Het
Tango2 T A 16: 18,301,539 I143F probably damaging Het
Thsd7a T C 6: 12,468,929 H550R probably damaging Het
Tmem131 T A 1: 36,881,342 Q92H probably benign Het
Tnfrsf21 T C 17: 43,017,088 L31P probably benign Het
Ttn A T 2: 76,900,143 probably benign Het
Ubash3b T C 9: 41,014,972 D493G probably damaging Het
Unc13a C T 8: 71,637,809 G1411D possibly damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfc3h1 A T 10: 115,401,748 R477S probably damaging Het
Zfp87 C T 13: 67,516,867 R492K probably benign Het
Other mutations in Tagap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Tagap APN 17 7932948 missense probably benign 0.01
IGL02589:Tagap APN 17 7933672 missense possibly damaging 0.87
R1750:Tagap UTSW 17 7929910 missense probably benign 0.06
R1791:Tagap UTSW 17 7931467 missense probably damaging 1.00
R1791:Tagap UTSW 17 7933545 missense probably benign 0.04
R2509:Tagap UTSW 17 7928754 missense probably benign 0.00
R4093:Tagap UTSW 17 7929423 missense probably damaging 1.00
R4627:Tagap UTSW 17 7926941 splice site probably null
R4747:Tagap UTSW 17 7932198 missense probably benign
R5222:Tagap UTSW 17 7933641 missense possibly damaging 0.61
R5222:Tagap UTSW 17 7933642 missense possibly damaging 0.92
R5866:Tagap UTSW 17 7933453 missense probably damaging 0.98
R6638:Tagap UTSW 17 7927074 missense possibly damaging 0.71
R6649:Tagap UTSW 17 7933714 missense probably benign 0.36
R6653:Tagap UTSW 17 7933714 missense probably benign 0.36
R7478:Tagap UTSW 17 7933590 missense possibly damaging 0.87
R7509:Tagap UTSW 17 7928736 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGCCTTCTCACCATGGAG -3'
(R):5'- CAGGCAAAATTTGGTGTCACC -3'

Sequencing Primer
(F):5'- GGTGACCTCAGTGAAGGGACAC -3'
(R):5'- TGTCACCGTGTGAGCCATC -3'
Posted On2018-05-04