Incidental Mutation 'R6392:Tnfrsf21'
ID515834
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6392 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43017088 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 31 (L31P)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: L31P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: L31P

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.2316 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T C 6: 41,032,372 Y176C probably damaging Het
Aars2 A T 17: 45,514,600 I330F probably damaging Het
Abcc9 A G 6: 142,682,099 S402P probably damaging Het
Ada A G 2: 163,728,217 L292P probably damaging Het
Adra1d T C 2: 131,561,609 D187G probably damaging Het
AI467606 C A 7: 127,092,545 Y97* probably null Het
Arid2 A G 15: 96,361,602 E245G probably damaging Het
Ccdc78 C G 17: 25,788,174 Q213E probably damaging Het
Cntnap1 G T 11: 101,186,646 D1045Y probably damaging Het
Ctcf T C 8: 105,664,133 V124A probably damaging Het
Cutc T C 19: 43,760,050 S129P possibly damaging Het
Dhx36 T C 3: 62,494,369 I308V probably benign Het
Disp2 T C 2: 118,790,749 V654A probably damaging Het
Esm1 G A 13: 113,209,749 probably benign Het
Extl1 C T 4: 134,364,634 V303I probably benign Het
Ezh1 G T 11: 101,203,804 D387E probably damaging Het
Fbf1 T A 11: 116,152,949 probably null Het
Fbxl12 T C 9: 20,639,176 H84R probably damaging Het
Fbxo6 C T 4: 148,146,005 V267I probably benign Het
Gm5346 A T 8: 43,626,001 N395K probably benign Het
Helz G T 11: 107,602,341 A197S possibly damaging Het
Ikbke T C 1: 131,275,146 probably null Het
Kbtbd13 A G 9: 65,390,337 F439S possibly damaging Het
Kif7 G A 7: 79,702,186 R943W probably damaging Het
Lrp12 C T 15: 39,872,019 C839Y probably damaging Het
Matr3 A G 18: 35,584,841 D364G probably benign Het
Ncam1 T C 9: 49,523,575 K624E probably damaging Het
Nup205 T C 6: 35,189,885 S280P possibly damaging Het
Olfr1196 A T 2: 88,700,667 Y221N probably damaging Het
Olfr622 A C 7: 103,639,682 C153G probably benign Het
Pira2 A T 7: 3,843,902 S214T possibly damaging Het
Ptpn4 T A 1: 119,773,123 I30F probably benign Het
Rnf144a T C 12: 26,310,780 I253V possibly damaging Het
Sh3pxd2b T A 11: 32,423,302 L823Q possibly damaging Het
Sh3rf3 A T 10: 59,007,076 D288V probably damaging Het
Shprh T A 10: 11,178,741 Y1031* probably null Het
Sidt1 T C 16: 44,291,294 T173A possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Ssh3 C T 19: 4,265,371 R309H probably benign Het
Tagap G T 17: 7,934,061 G693W probably damaging Het
Tango2 T A 16: 18,301,539 I143F probably damaging Het
Thsd7a T C 6: 12,468,929 H550R probably damaging Het
Tmem131 T A 1: 36,881,342 Q92H probably benign Het
Ttn A T 2: 76,900,143 probably benign Het
Ubash3b T C 9: 41,014,972 D493G probably damaging Het
Unc13a C T 8: 71,637,809 G1411D possibly damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfc3h1 A T 10: 115,401,748 R477S probably damaging Het
Zfp87 C T 13: 67,516,867 R492K probably benign Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
palmer_park UTSW 17 43038010 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTAGCACTGTCGCGGCTAG -3'
(R):5'- TTCAAGCAGCCAGATTGCAAG -3'

Sequencing Primer
(F):5'- TGCTGCAGTGCACATGG -3'
(R):5'- ATTCTTTAACACTCACTAGCCTTAGC -3'
Posted On2018-05-04