Incidental Mutation 'R6392:Aars2'
ID515835
Institutional Source Beutler Lab
Gene Symbol Aars2
Ensembl Gene ENSMUSG00000023938
Gene Namealanyl-tRNA synthetase 2, mitochondrial
SynonymsAarsl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6392 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location45506841-45520842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45514600 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 330 (I330F)
Ref Sequence ENSEMBL: ENSMUSP00000024733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024733]
Predicted Effect probably damaging
Transcript: ENSMUST00000024733
AA Change: I330F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: I330F

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:tRNA-synt_2c 36 619 4e-175 PFAM
low complexity region 663 674 N/A INTRINSIC
tRNA_SAD 716 774 2.65e-10 SMART
coiled coil region 833 863 N/A INTRINSIC
Meta Mutation Damage Score 0.4840 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T C 6: 41,032,372 Y176C probably damaging Het
Abcc9 A G 6: 142,682,099 S402P probably damaging Het
Ada A G 2: 163,728,217 L292P probably damaging Het
Adra1d T C 2: 131,561,609 D187G probably damaging Het
AI467606 C A 7: 127,092,545 Y97* probably null Het
Arid2 A G 15: 96,361,602 E245G probably damaging Het
Ccdc78 C G 17: 25,788,174 Q213E probably damaging Het
Cntnap1 G T 11: 101,186,646 D1045Y probably damaging Het
Ctcf T C 8: 105,664,133 V124A probably damaging Het
Cutc T C 19: 43,760,050 S129P possibly damaging Het
Dhx36 T C 3: 62,494,369 I308V probably benign Het
Disp2 T C 2: 118,790,749 V654A probably damaging Het
Esm1 G A 13: 113,209,749 probably benign Het
Extl1 C T 4: 134,364,634 V303I probably benign Het
Ezh1 G T 11: 101,203,804 D387E probably damaging Het
Fbf1 T A 11: 116,152,949 probably null Het
Fbxl12 T C 9: 20,639,176 H84R probably damaging Het
Fbxo6 C T 4: 148,146,005 V267I probably benign Het
Gm5346 A T 8: 43,626,001 N395K probably benign Het
Helz G T 11: 107,602,341 A197S possibly damaging Het
Ikbke T C 1: 131,275,146 probably null Het
Kbtbd13 A G 9: 65,390,337 F439S possibly damaging Het
Kif7 G A 7: 79,702,186 R943W probably damaging Het
Lrp12 C T 15: 39,872,019 C839Y probably damaging Het
Matr3 A G 18: 35,584,841 D364G probably benign Het
Ncam1 T C 9: 49,523,575 K624E probably damaging Het
Nup205 T C 6: 35,189,885 S280P possibly damaging Het
Olfr1196 A T 2: 88,700,667 Y221N probably damaging Het
Olfr622 A C 7: 103,639,682 C153G probably benign Het
Pira2 A T 7: 3,843,902 S214T possibly damaging Het
Ptpn4 T A 1: 119,773,123 I30F probably benign Het
Rnf144a T C 12: 26,310,780 I253V possibly damaging Het
Sh3pxd2b T A 11: 32,423,302 L823Q possibly damaging Het
Sh3rf3 A T 10: 59,007,076 D288V probably damaging Het
Shprh T A 10: 11,178,741 Y1031* probably null Het
Sidt1 T C 16: 44,291,294 T173A possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Ssh3 C T 19: 4,265,371 R309H probably benign Het
Tagap G T 17: 7,934,061 G693W probably damaging Het
Tango2 T A 16: 18,301,539 I143F probably damaging Het
Thsd7a T C 6: 12,468,929 H550R probably damaging Het
Tmem131 T A 1: 36,881,342 Q92H probably benign Het
Tnfrsf21 T C 17: 43,017,088 L31P probably benign Het
Ttn A T 2: 76,900,143 probably benign Het
Ubash3b T C 9: 41,014,972 D493G probably damaging Het
Unc13a C T 8: 71,637,809 G1411D possibly damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfc3h1 A T 10: 115,401,748 R477S probably damaging Het
Zfp87 C T 13: 67,516,867 R492K probably benign Het
Other mutations in Aars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02958:Aars2 APN 17 45518172 missense probably benign 0.00
dread_pirate UTSW 17 45516564 missense probably damaging 1.00
R0266:Aars2 UTSW 17 45507510 splice site probably benign
R0315:Aars2 UTSW 17 45515452 missense possibly damaging 0.67
R0375:Aars2 UTSW 17 45514550 missense probably damaging 0.99
R0629:Aars2 UTSW 17 45507547 missense probably damaging 0.99
R0981:Aars2 UTSW 17 45520331 missense probably damaging 1.00
R1878:Aars2 UTSW 17 45514638 critical splice donor site probably null
R1893:Aars2 UTSW 17 45514799 missense probably benign 0.14
R2035:Aars2 UTSW 17 45514801 missense possibly damaging 0.87
R2099:Aars2 UTSW 17 45506894 missense unknown
R4342:Aars2 UTSW 17 45516495 missense probably benign
R4600:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4601:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4610:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R5158:Aars2 UTSW 17 45514829 missense probably benign 0.07
R5943:Aars2 UTSW 17 45517711 missense probably benign 0.30
R5992:Aars2 UTSW 17 45508623 nonsense probably null
R6255:Aars2 UTSW 17 45514609 missense probably damaging 1.00
R6381:Aars2 UTSW 17 45518545 missense probably benign 0.04
R6406:Aars2 UTSW 17 45506939 missense probably benign 0.16
R6648:Aars2 UTSW 17 45516564 missense probably damaging 1.00
R7135:Aars2 UTSW 17 45508961 nonsense probably null
R7197:Aars2 UTSW 17 45508959 missense probably damaging 1.00
R7203:Aars2 UTSW 17 45516571 missense probably damaging 1.00
R7289:Aars2 UTSW 17 45507624 missense probably damaging 0.99
R7669:Aars2 UTSW 17 45520295 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCTACAGGATGTGGTGGTC -3'
(R):5'- AACTAGCCTGGAGGGTTTCAG -3'

Sequencing Primer
(F):5'- TTATGGCTGTGAACAAGCATGCAC -3'
(R):5'- GTTTCAGAGCACAGACGTGACC -3'
Posted On2018-05-04