Incidental Mutation 'R6393:Ank2'
ID515857
Institutional Source Beutler Lab
Gene Symbol Ank2
Ensembl Gene ENSMUSG00000032826
Gene Nameankyrin 2, brain
SynonymsAnkyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6393 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location126921612-127499350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126929757 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 974 (R974C)
Ref Sequence ENSEMBL: ENSMUSP00000043765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078]
Predicted Effect probably damaging
Transcript: ENSMUST00000044443
AA Change: R974C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826
AA Change: R974C

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
ZU5 128 232 4.13e-61 SMART
Pfam:ZU5 289 374 2.8e-8 PFAM
low complexity region 587 597 N/A INTRINSIC
DEATH 603 697 1.52e-27 SMART
low complexity region 732 748 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182064
AA Change: R3911C
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: R3911C

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182078
AA Change: R3824C
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: R3824C

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182118
AA Change: R19C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182271
Predicted Effect unknown
Transcript: ENSMUST00000182571
AA Change: R19C
Meta Mutation Damage Score 0.3052 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 99% (70/71)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,382 Q14R possibly damaging Het
Adamts12 A G 15: 11,255,635 D430G probably damaging Het
Agxt2 T C 15: 10,393,808 probably null Het
Akirin1 T G 4: 123,743,531 Q87P possibly damaging Het
Arhgap23 A G 11: 97,463,672 I804V probably damaging Het
Arhgef28 A T 13: 97,994,019 L437Q possibly damaging Het
Atp8a2 G T 14: 59,773,755 Y967* probably null Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Ccdc80 T A 16: 45,096,465 V528D possibly damaging Het
Chd6 A G 2: 160,979,487 Y1296H probably damaging Het
Chst13 G A 6: 90,325,081 R28C possibly damaging Het
Clrn1 A G 3: 58,846,320 F207L probably damaging Het
Col12a1 T C 9: 79,655,485 T1772A probably damaging Het
Cubn T C 2: 13,355,680 T1744A probably benign Het
Dchs2 A G 3: 83,129,911 E655G probably damaging Het
Dnajb3 T A 1: 88,205,662 E6V possibly damaging Het
Dock5 G A 14: 67,822,602 P463S probably benign Het
Fancd2 T A 6: 113,578,413 C1128S probably benign Het
Fcrl5 G A 3: 87,448,327 G449E probably damaging Het
Frem2 G T 3: 53,585,640 N1818K possibly damaging Het
Gm21149 C A 5: 15,473,039 V187L possibly damaging Het
Gm8994 A G 6: 136,328,598 K19R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gstm7 A G 3: 107,930,826 probably null Het
Htr1b T A 9: 81,631,757 I266F probably benign Het
Jakmip3 T C 7: 139,019,171 I305T probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kifc5b T C 17: 26,921,842 C97R probably benign Het
Klhl30 A T 1: 91,361,190 H557L probably damaging Het
Lama3 T C 18: 12,479,756 V1199A probably benign Het
Lmbr1 A G 5: 29,254,294 L246P probably damaging Het
M6pr T C 6: 122,315,380 L178P possibly damaging Het
Med17 A G 9: 15,274,583 S212P probably damaging Het
Med23 T A 10: 24,873,476 S31T possibly damaging Het
Morc2b T G 17: 33,137,776 T341P probably damaging Het
Mre11a A G 9: 14,785,509 M1V probably null Het
Mrpl17 T C 7: 105,809,915 H158R probably benign Het
Mstn A G 1: 53,066,489 Q330R probably benign Het
Muc16 T A 9: 18,647,399 K2533* probably null Het
N4bp2 T C 5: 65,791,001 S325P possibly damaging Het
Nadk A G 4: 155,589,351 Y399C possibly damaging Het
Nbea A C 3: 56,091,119 L89R probably damaging Het
Ncoa1 A G 12: 4,278,181 F775L probably benign Het
Ndufa11 C A 17: 56,721,331 A70E probably damaging Het
Nfx1 A G 4: 40,976,851 Y175C possibly damaging Het
Olfr1121 A G 2: 87,371,565 N11S probably damaging Het
Olfr1419 A T 19: 11,870,727 L163Q probably damaging Het
Pcsk6 T C 7: 65,969,014 S443P probably damaging Het
Pcsk9 T C 4: 106,447,596 D425G probably benign Het
Pdcd1lg2 T A 19: 29,437,298 C42S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rbm46 G A 3: 82,863,955 T451M probably benign Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Rpl7l1 T C 17: 46,782,622 E4G probably benign Het
Rptn A G 3: 93,397,199 E613G probably benign Het
Sbk2 T C 7: 4,957,622 D183G probably damaging Het
Slc15a4 C T 5: 127,616,886 A162T probably benign Het
Slc30a4 A G 2: 122,686,046 W315R probably damaging Het
Slc39a14 G C 14: 70,309,813 F361L probably benign Het
Slc6a13 T C 6: 121,336,842 Y515H possibly damaging Het
Slitrk3 C A 3: 73,049,914 K508N possibly damaging Het
Stard4 T C 18: 33,205,225 D144G probably benign Het
Tlr9 T C 9: 106,224,937 F476L probably damaging Het
Tshz1 A T 18: 84,013,220 V1021D probably damaging Het
Vmn1r54 A T 6: 90,269,322 I73F probably benign Het
Vmn2r19 A C 6: 123,316,153 S385R possibly damaging Het
Xkr5 A G 8: 18,948,700 L34P probably damaging Het
Xpo4 A G 14: 57,638,313 V121A probably damaging Het
Zbtb40 T A 4: 136,984,866 H268L probably null Het
Zfp865 T C 7: 5,030,066 F350S probably damaging Het
Zscan4b T C 7: 10,900,901 I472V possibly damaging Het
Other mutations in Ank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Ank2 APN 3 126959720 missense possibly damaging 0.80
IGL01652:Ank2 APN 3 126933041 missense probably benign 0.00
IGL01969:Ank2 APN 3 126953223 missense possibly damaging 0.47
IGL02122:Ank2 APN 3 126937874 splice site probably benign
IGL02537:Ank2 APN 3 126955916 missense probably damaging 1.00
IGL02858:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL02981:Ank2 APN 3 126934562 missense possibly damaging 0.58
IGL02981:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03024:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03074:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03111:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03129:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03174:Ank2 APN 3 126940095 missense probably damaging 0.98
IGL03177:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03185:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03188:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03242:Ank2 APN 3 126928805 missense possibly damaging 0.90
IGL03244:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03248:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03285:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03304:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03358:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03380:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03389:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03400:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03409:Ank2 APN 3 126955870 missense probably damaging 1.00
ballast UTSW 3 126943133 missense unknown
Chain UTSW 3 126946938 intron probably benign
drag UTSW 3 127003982 missense probably damaging 1.00
mooring UTSW 3 126934577 missense possibly damaging 0.73
Windlass UTSW 3 126946149 missense probably benign
R0033:Ank2 UTSW 3 127104748 splice site probably benign
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0079:Ank2 UTSW 3 126934615 missense probably benign 0.01
R0423:Ank2 UTSW 3 126929860 nonsense probably null
R0699:Ank2 UTSW 3 126929829 missense probably benign 0.00
R0724:Ank2 UTSW 3 126962337 missense probably damaging 1.00
R0990:Ank2 UTSW 3 126934666 missense possibly damaging 0.64
R1450:Ank2 UTSW 3 126957302 missense possibly damaging 0.94
R1500:Ank2 UTSW 3 126932982 missense probably benign
R1702:Ank2 UTSW 3 126955899 missense probably benign 0.00
R1703:Ank2 UTSW 3 126929766 missense probably damaging 1.00
R1710:Ank2 UTSW 3 126933060 nonsense probably null
R1743:Ank2 UTSW 3 126928675 missense probably damaging 0.99
R1775:Ank2 UTSW 3 126934547 missense probably benign 0.00
R1852:Ank2 UTSW 3 126997851 critical splice donor site probably null
R2198:Ank2 UTSW 3 126934577 missense possibly damaging 0.73
R2892:Ank2 UTSW 3 127248243 splice site probably null
R2893:Ank2 UTSW 3 127248243 splice site probably null
R2894:Ank2 UTSW 3 127248243 splice site probably null
R3148:Ank2 UTSW 3 126933075 missense probably benign 0.00
R3776:Ank2 UTSW 3 126942262 intron probably benign
R3784:Ank2 UTSW 3 126953193 missense probably damaging 1.00
R3856:Ank2 UTSW 3 126929844 missense probably benign 0.00
R3906:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3907:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3953:Ank2 UTSW 3 126988160 missense probably damaging 1.00
R3963:Ank2 UTSW 3 126934596 missense probably benign
R4367:Ank2 UTSW 3 126946149 missense probably benign
R4414:Ank2 UTSW 3 127225762 critical splice donor site probably null
R4432:Ank2 UTSW 3 126947806 intron probably benign
R4433:Ank2 UTSW 3 126947806 intron probably benign
R4579:Ank2 UTSW 3 126958963 missense probably damaging 1.00
R4597:Ank2 UTSW 3 126988151 missense probably damaging 1.00
R4603:Ank2 UTSW 3 127032016 missense probably benign 0.00
R4729:Ank2 UTSW 3 126976896 nonsense probably null
R4815:Ank2 UTSW 3 126936761 missense probably benign
R4826:Ank2 UTSW 3 126956001 missense probably benign 0.35
R4871:Ank2 UTSW 3 126959795 missense probably damaging 1.00
R4880:Ank2 UTSW 3 127046826 splice site probably null
R4915:Ank2 UTSW 3 126942671 intron probably benign
R4935:Ank2 UTSW 3 126956064 missense probably damaging 1.00
R4936:Ank2 UTSW 3 126955039 missense possibly damaging 0.94
R4937:Ank2 UTSW 3 126962401 missense probably damaging 1.00
R4946:Ank2 UTSW 3 126941940 intron probably benign
R4963:Ank2 UTSW 3 127032096 missense probably benign 0.01
R4989:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5023:Ank2 UTSW 3 126941871 intron probably benign
R5060:Ank2 UTSW 3 126945921 intron probably benign
R5078:Ank2 UTSW 3 126942353 intron probably benign
R5086:Ank2 UTSW 3 126947348 intron probably benign
R5134:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5148:Ank2 UTSW 3 127025636 splice site probably null
R5175:Ank2 UTSW 3 127004024 missense probably damaging 1.00
R5275:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5295:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5303:Ank2 UTSW 3 126945804 intron probably benign
R5309:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5312:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5352:Ank2 UTSW 3 127498991 utr 5 prime probably benign
R5355:Ank2 UTSW 3 126944049 intron probably benign
R5386:Ank2 UTSW 3 126981933 missense probably benign 0.01
R5396:Ank2 UTSW 3 126953226 missense probably damaging 1.00
R5518:Ank2 UTSW 3 126959699 missense probably damaging 0.98
R5534:Ank2 UTSW 3 126947298 intron probably benign
R5554:Ank2 UTSW 3 126998973 missense possibly damaging 0.78
R5582:Ank2 UTSW 3 126946305 intron probably benign
R5747:Ank2 UTSW 3 126941751 intron probably benign
R5794:Ank2 UTSW 3 126930020 missense probably benign 0.00
R5831:Ank2 UTSW 3 127339159 start gained probably benign
R5925:Ank2 UTSW 3 126932963 missense probably benign 0.18
R5954:Ank2 UTSW 3 126997861 missense probably benign 0.34
R5956:Ank2 UTSW 3 126942688 intron probably benign
R5986:Ank2 UTSW 3 127012686 missense possibly damaging 0.94
R5992:Ank2 UTSW 3 126959651 critical splice donor site probably null
R6020:Ank2 UTSW 3 126946821 intron probably benign
R6027:Ank2 UTSW 3 126997879 missense possibly damaging 0.92
R6049:Ank2 UTSW 3 126943020 missense possibly damaging 0.95
R6060:Ank2 UTSW 3 126955952 missense probably damaging 1.00
R6114:Ank2 UTSW 3 127011051 missense probably damaging 1.00
R6124:Ank2 UTSW 3 127248151 missense probably benign 0.31
R6156:Ank2 UTSW 3 126944237 missense probably damaging 1.00
R6173:Ank2 UTSW 3 127052746 missense probably damaging 1.00
R6176:Ank2 UTSW 3 126945471 missense probably benign 0.05
R6184:Ank2 UTSW 3 126962398 missense probably damaging 1.00
R6199:Ank2 UTSW 3 127004006 missense probably damaging 1.00
R6241:Ank2 UTSW 3 127052748 missense probably damaging 1.00
R6254:Ank2 UTSW 3 126941804 intron probably benign
R6259:Ank2 UTSW 3 127016986 missense probably benign 0.28
R6260:Ank2 UTSW 3 126943557 missense probably benign
R6321:Ank2 UTSW 3 126946938 intron probably benign
R6406:Ank2 UTSW 3 127032225 missense probably damaging 1.00
R6544:Ank2 UTSW 3 126933222 missense probably damaging 0.99
R6583:Ank2 UTSW 3 127016964 missense probably damaging 1.00
R6739:Ank2 UTSW 3 127079994 missense probably damaging 1.00
R6754:Ank2 UTSW 3 127096839 intron probably benign
R6786:Ank2 UTSW 3 126958932 missense probably damaging 0.99
R6798:Ank2 UTSW 3 126944264 intron probably benign
R6882:Ank2 UTSW 3 126945757 intron probably benign
R6940:Ank2 UTSW 3 126941972 intron probably benign
R6949:Ank2 UTSW 3 127010884 missense probably benign 0.00
R7001:Ank2 UTSW 3 127077581 missense probably damaging 1.00
R7033:Ank2 UTSW 3 126944850 nonsense probably null
R7036:Ank2 UTSW 3 126946392 intron probably benign
R7045:Ank2 UTSW 3 127012744 missense probably damaging 1.00
R7048:Ank2 UTSW 3 127025618 missense probably benign 0.03
R7054:Ank2 UTSW 3 126943303 intron probably benign
R7069:Ank2 UTSW 3 126946298 intron probably benign
R7091:Ank2 UTSW 3 127023351 missense probably damaging 0.98
R7107:Ank2 UTSW 3 127003982 missense probably damaging 1.00
R7175:Ank2 UTSW 3 126946941 missense unknown
R7191:Ank2 UTSW 3 126946392 missense unknown
R7272:Ank2 UTSW 3 126943133 missense unknown
R7381:Ank2 UTSW 3 126936628 missense possibly damaging 0.46
R7394:Ank2 UTSW 3 126936653 missense possibly damaging 0.77
R7462:Ank2 UTSW 3 126943034 missense unknown
R7490:Ank2 UTSW 3 126958889 missense probably damaging 0.99
R7514:Ank2 UTSW 3 127025603 missense probably benign 0.06
R7534:Ank2 UTSW 3 126934333 splice site probably null
R7540:Ank2 UTSW 3 126988159 missense possibly damaging 0.94
R7547:Ank2 UTSW 3 126945203 missense unknown
R7579:Ank2 UTSW 3 126946398 missense unknown
R7584:Ank2 UTSW 3 126946128 nonsense probably null
R7625:Ank2 UTSW 3 127052800 missense probably damaging 1.00
R7698:Ank2 UTSW 3 127032211 missense probably benign 0.35
R7716:Ank2 UTSW 3 126943166 missense unknown
R7718:Ank2 UTSW 3 126965013 missense possibly damaging 0.88
R7722:Ank2 UTSW 3 127029302 missense probably benign 0.01
R7738:Ank2 UTSW 3 126947622 missense
R7977:Ank2 UTSW 3 126945707 missense unknown
R7987:Ank2 UTSW 3 126945707 missense unknown
R8007:Ank2 UTSW 3 126936447 intron probably benign
R8150:Ank2 UTSW 3 126947513 missense
R8161:Ank2 UTSW 3 127032129 missense
R8196:Ank2 UTSW 3 126929883 missense probably damaging 0.99
R8248:Ank2 UTSW 3 126937785 missense possibly damaging 0.78
R8255:Ank2 UTSW 3 126946749 missense unknown
R8279:Ank2 UTSW 3 126933171 missense probably benign 0.04
R8300:Ank2 UTSW 3 127010906 missense
RF020:Ank2 UTSW 3 126945476 missense unknown
Z1088:Ank2 UTSW 3 127029509 missense possibly damaging 0.45
Z1177:Ank2 UTSW 3 126944357 missense unknown
Predicted Primers PCR Primer
(F):5'- GACAATGAGTATAATGGCCACATG -3'
(R):5'- CCGTGGTGAAGAAGGTACTG -3'

Sequencing Primer
(F):5'- TGGCCACATGAAATTGAGATTCAG -3'
(R):5'- CAAAGGCTATCACTAGTGTGGTTCC -3'
Posted On2018-05-04