Incidental Mutation 'R6393:M6pr'
ID515873
Institutional Source Beutler Lab
Gene Symbol M6pr
Ensembl Gene ENSMUSG00000007458
Gene Namemannose-6-phosphate receptor, cation dependent
SynonymsMpr46, CD-MPR
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6393 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122308720-122317680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122315380 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 178 (L178P)
Ref Sequence ENSEMBL: ENSMUSP00000108229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007602] [ENSMUST00000079560] [ENSMUST00000081849] [ENSMUST00000112600] [ENSMUST00000112610] [ENSMUST00000159252] [ENSMUST00000160163] [ENSMUST00000160696] [ENSMUST00000161054] [ENSMUST00000161739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007602
AA Change: L178P

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007602
Gene: ENSMUSG00000007458
AA Change: L178P

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 4.5e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079560
SMART Domains Protein: ENSMUSP00000078514
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081849
SMART Domains Protein: ENSMUSP00000080532
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112600
SMART Domains Protein: ENSMUSP00000108219
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112610
AA Change: L178P

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108229
Gene: ENSMUSG00000007458
AA Change: L178P

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 3.9e-200 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123093
Predicted Effect probably benign
Transcript: ENSMUST00000159252
SMART Domains Protein: ENSMUSP00000124678
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 46 65 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 195 258 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 328 371 N/A INTRINSIC
coiled coil region 375 401 N/A INTRINSIC
low complexity region 403 435 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 530 542 N/A INTRINSIC
low complexity region 572 583 N/A INTRINSIC
low complexity region 659 677 N/A INTRINSIC
Pfam:zf-FCS 753 788 2.2e-8 PFAM
low complexity region 810 824 N/A INTRINSIC
SAM 898 965 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160163
SMART Domains Protein: ENSMUSP00000125545
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160696
SMART Domains Protein: ENSMUSP00000125580
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 834 941 3.4e-31 PFAM
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161054
SMART Domains Protein: ENSMUSP00000123911
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161739
SMART Domains Protein: ENSMUSP00000125568
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161877
SMART Domains Protein: ENSMUSP00000123854
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Meta Mutation Damage Score 0.2974 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and display no visible phenotypic abnormalities; however, serum levels of lysosomal enzymes are elevated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,382 Q14R possibly damaging Het
Adamts12 A G 15: 11,255,635 D430G probably damaging Het
Agxt2 T C 15: 10,393,808 probably null Het
Akirin1 T G 4: 123,743,531 Q87P possibly damaging Het
Ank2 G A 3: 126,929,757 R974C probably damaging Het
Arhgap23 A G 11: 97,463,672 I804V probably damaging Het
Arhgef28 A T 13: 97,994,019 L437Q possibly damaging Het
Atp8a2 G T 14: 59,773,755 Y967* probably null Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Ccdc80 T A 16: 45,096,465 V528D possibly damaging Het
Chd6 A G 2: 160,979,487 Y1296H probably damaging Het
Chst13 G A 6: 90,325,081 R28C possibly damaging Het
Clrn1 A G 3: 58,846,320 F207L probably damaging Het
Col12a1 T C 9: 79,655,485 T1772A probably damaging Het
Cubn T C 2: 13,355,680 T1744A probably benign Het
Dchs2 A G 3: 83,129,911 E655G probably damaging Het
Dnajb3 T A 1: 88,205,662 E6V possibly damaging Het
Dock5 G A 14: 67,822,602 P463S probably benign Het
Fancd2 T A 6: 113,578,413 C1128S probably benign Het
Fcrl5 G A 3: 87,448,327 G449E probably damaging Het
Frem2 G T 3: 53,585,640 N1818K possibly damaging Het
Gm21149 C A 5: 15,473,039 V187L possibly damaging Het
Gm8994 A G 6: 136,328,598 K19R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gstm7 A G 3: 107,930,826 probably null Het
Htr1b T A 9: 81,631,757 I266F probably benign Het
Jakmip3 T C 7: 139,019,171 I305T probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kifc5b T C 17: 26,921,842 C97R probably benign Het
Klhl30 A T 1: 91,361,190 H557L probably damaging Het
Lama3 T C 18: 12,479,756 V1199A probably benign Het
Lmbr1 A G 5: 29,254,294 L246P probably damaging Het
Med17 A G 9: 15,274,583 S212P probably damaging Het
Med23 T A 10: 24,873,476 S31T possibly damaging Het
Morc2b T G 17: 33,137,776 T341P probably damaging Het
Mre11a A G 9: 14,785,509 M1V probably null Het
Mrpl17 T C 7: 105,809,915 H158R probably benign Het
Mstn A G 1: 53,066,489 Q330R probably benign Het
Muc16 T A 9: 18,647,399 K2533* probably null Het
N4bp2 T C 5: 65,791,001 S325P possibly damaging Het
Nadk A G 4: 155,589,351 Y399C possibly damaging Het
Nbea A C 3: 56,091,119 L89R probably damaging Het
Ncoa1 A G 12: 4,278,181 F775L probably benign Het
Ndufa11 C A 17: 56,721,331 A70E probably damaging Het
Nfx1 A G 4: 40,976,851 Y175C possibly damaging Het
Olfr1121 A G 2: 87,371,565 N11S probably damaging Het
Olfr1419 A T 19: 11,870,727 L163Q probably damaging Het
Pcsk6 T C 7: 65,969,014 S443P probably damaging Het
Pcsk9 T C 4: 106,447,596 D425G probably benign Het
Pdcd1lg2 T A 19: 29,437,298 C42S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rbm46 G A 3: 82,863,955 T451M probably benign Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Rpl7l1 T C 17: 46,782,622 E4G probably benign Het
Rptn A G 3: 93,397,199 E613G probably benign Het
Sbk2 T C 7: 4,957,622 D183G probably damaging Het
Slc15a4 C T 5: 127,616,886 A162T probably benign Het
Slc30a4 A G 2: 122,686,046 W315R probably damaging Het
Slc39a14 G C 14: 70,309,813 F361L probably benign Het
Slc6a13 T C 6: 121,336,842 Y515H possibly damaging Het
Slitrk3 C A 3: 73,049,914 K508N possibly damaging Het
Stard4 T C 18: 33,205,225 D144G probably benign Het
Tlr9 T C 9: 106,224,937 F476L probably damaging Het
Tshz1 A T 18: 84,013,220 V1021D probably damaging Het
Vmn1r54 A T 6: 90,269,322 I73F probably benign Het
Vmn2r19 A C 6: 123,316,153 S385R possibly damaging Het
Xkr5 A G 8: 18,948,700 L34P probably damaging Het
Xpo4 A G 14: 57,638,313 V121A probably damaging Het
Zbtb40 T A 4: 136,984,866 H268L probably null Het
Zfp865 T C 7: 5,030,066 F350S probably damaging Het
Zscan4b T C 7: 10,900,901 I472V possibly damaging Het
Other mutations in M6pr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:M6pr APN 6 122313378 missense probably damaging 0.99
IGL00899:M6pr APN 6 122315395 missense possibly damaging 0.60
IGL01291:M6pr APN 6 122312259 missense probably benign 0.08
IGL02010:M6pr APN 6 122315126 missense possibly damaging 0.70
IGL02200:M6pr APN 6 122315068 missense probably benign 0.25
ANU05:M6pr UTSW 6 122312259 missense probably benign 0.08
R1559:M6pr UTSW 6 122315074 missense probably benign 0.06
R2015:M6pr UTSW 6 122313373 missense probably damaging 0.99
R2144:M6pr UTSW 6 122315367 missense probably benign 0.04
R4402:M6pr UTSW 6 122315023 unclassified probably benign
R4466:M6pr UTSW 6 122313269 missense probably benign 0.23
R5270:M6pr UTSW 6 122315089 missense possibly damaging 0.90
R6306:M6pr UTSW 6 122315162 splice site probably null
R6583:M6pr UTSW 6 122313390 missense probably damaging 0.96
R8504:M6pr UTSW 6 122316070 missense possibly damaging 0.92
RF016:M6pr UTSW 6 122315165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAAATGATTGGGCTTTATGC -3'
(R):5'- AGCCATGGATCACTATTATTGGG -3'

Sequencing Primer
(F):5'- GCTTTATGCATTTATCAGAGGCAGTC -3'
(R):5'- AGCCAGGTCTGATCAGGTACATC -3'
Posted On2018-05-04