Incidental Mutation 'R6393:Vmn2r19'
ID 515874
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Name vomeronasal 2, receptor 19
Synonyms EG232358
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6393 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 123308333-123336537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 123316153 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 385 (S385R)
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
AlphaFold G5E8G4
Predicted Effect possibly damaging
Transcript: ENSMUST00000073948
AA Change: S385R

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: S385R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,382 Q14R possibly damaging Het
Adamts12 A G 15: 11,255,635 D430G probably damaging Het
Agxt2 T C 15: 10,393,808 probably null Het
Akirin1 T G 4: 123,743,531 Q87P possibly damaging Het
Ank2 G A 3: 126,929,757 R974C probably damaging Het
Arhgap23 A G 11: 97,463,672 I804V probably damaging Het
Arhgef28 A T 13: 97,994,019 L437Q possibly damaging Het
Atp8a2 G T 14: 59,773,755 Y967* probably null Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Ccdc80 T A 16: 45,096,465 V528D possibly damaging Het
Chd6 A G 2: 160,979,487 Y1296H probably damaging Het
Chst13 G A 6: 90,325,081 R28C possibly damaging Het
Clrn1 A G 3: 58,846,320 F207L probably damaging Het
Col12a1 T C 9: 79,655,485 T1772A probably damaging Het
Cubn T C 2: 13,355,680 T1744A probably benign Het
Dchs2 A G 3: 83,129,911 E655G probably damaging Het
Dnajb3 T A 1: 88,205,662 E6V possibly damaging Het
Dock5 G A 14: 67,822,602 P463S probably benign Het
Fancd2 T A 6: 113,578,413 C1128S probably benign Het
Fcrl5 G A 3: 87,448,327 G449E probably damaging Het
Frem2 G T 3: 53,585,640 N1818K possibly damaging Het
Gm21149 C A 5: 15,473,039 V187L possibly damaging Het
Gm8994 A G 6: 136,328,598 K19R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gstm7 A G 3: 107,930,826 probably null Het
Htr1b T A 9: 81,631,757 I266F probably benign Het
Jakmip3 T C 7: 139,019,171 I305T probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kifc5b T C 17: 26,921,842 C97R probably benign Het
Klhl30 A T 1: 91,361,190 H557L probably damaging Het
Lama3 T C 18: 12,479,756 V1199A probably benign Het
Lmbr1 A G 5: 29,254,294 L246P probably damaging Het
M6pr T C 6: 122,315,380 L178P possibly damaging Het
Med17 A G 9: 15,274,583 S212P probably damaging Het
Med23 T A 10: 24,873,476 S31T possibly damaging Het
Morc2b T G 17: 33,137,776 T341P probably damaging Het
Mre11a A G 9: 14,785,509 M1V probably null Het
Mrpl17 T C 7: 105,809,915 H158R probably benign Het
Mstn A G 1: 53,066,489 Q330R probably benign Het
Muc16 T A 9: 18,647,399 K2533* probably null Het
N4bp2 T C 5: 65,791,001 S325P possibly damaging Het
Nadk A G 4: 155,589,351 Y399C possibly damaging Het
Nbea A C 3: 56,091,119 L89R probably damaging Het
Ncoa1 A G 12: 4,278,181 F775L probably benign Het
Ndufa11 C A 17: 56,721,331 A70E probably damaging Het
Nfx1 A G 4: 40,976,851 Y175C possibly damaging Het
Olfr1121 A G 2: 87,371,565 N11S probably damaging Het
Olfr1419 A T 19: 11,870,727 L163Q probably damaging Het
Pcsk6 T C 7: 65,969,014 S443P probably damaging Het
Pcsk9 T C 4: 106,447,596 D425G probably benign Het
Pdcd1lg2 T A 19: 29,437,298 C42S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rbm46 G A 3: 82,863,955 T451M probably benign Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Rpl7l1 T C 17: 46,782,622 E4G probably benign Het
Rptn A G 3: 93,397,199 E613G probably benign Het
Sbk2 T C 7: 4,957,622 D183G probably damaging Het
Slc15a4 C T 5: 127,616,886 A162T probably benign Het
Slc30a4 A G 2: 122,686,046 W315R probably damaging Het
Slc39a14 G C 14: 70,309,813 F361L probably benign Het
Slc6a13 T C 6: 121,336,842 Y515H possibly damaging Het
Slitrk3 C A 3: 73,049,914 K508N possibly damaging Het
Stard4 T C 18: 33,205,225 D144G probably benign Het
Tlr9 T C 9: 106,224,937 F476L probably damaging Het
Tshz1 A T 18: 84,013,220 V1021D probably damaging Het
Vmn1r54 A T 6: 90,269,322 I73F probably benign Het
Xkr5 A G 8: 18,948,700 L34P probably damaging Het
Xpo4 A G 14: 57,638,313 V121A probably damaging Het
Zbtb40 T A 4: 136,984,866 H268L probably null Het
Zfp865 T C 7: 5,030,066 F350S probably damaging Het
Zscan4b T C 7: 10,900,901 I472V possibly damaging Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123329867 missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123329978 missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123309662 missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123336083 missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123315902 missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123331547 missense probably benign 0.01
R0389:Vmn2r19 UTSW 6 123335986 missense possibly damaging 0.53
R0402:Vmn2r19 UTSW 6 123336182 missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123309744 missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123336143 missense probably damaging 0.99
R0578:Vmn2r19 UTSW 6 123335972 missense probably damaging 1.00
R1102:Vmn2r19 UTSW 6 123336173 missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123315697 missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123336452 missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123330052 missense possibly damaging 0.80
R1866:Vmn2r19 UTSW 6 123331638 critical splice donor site probably null
R1928:Vmn2r19 UTSW 6 123331630 missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123315921 missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123335836 missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123316074 missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123308330 splice site probably null
R2256:Vmn2r19 UTSW 6 123329886 missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123329978 missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123315589 missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123309642 missense probably damaging 1.00
R3929:Vmn2r19 UTSW 6 123315628 missense probably benign 0.01
R3934:Vmn2r19 UTSW 6 123315669 missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123329912 missense probably benign
R4574:Vmn2r19 UTSW 6 123315980 missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123309841 missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123329910 missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123309643 nonsense probably null
R5232:Vmn2r19 UTSW 6 123335957 missense probably benign
R6102:Vmn2r19 UTSW 6 123329948 missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123316095 missense possibly damaging 0.70
R6280:Vmn2r19 UTSW 6 123336253 missense probably benign
R6502:Vmn2r19 UTSW 6 123316108 missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123336535 makesense probably null
R6742:Vmn2r19 UTSW 6 123329958 missense possibly damaging 0.90
R7662:Vmn2r19 UTSW 6 123331562 missense probably benign 0.33
R8041:Vmn2r19 UTSW 6 123335791 missense possibly damaging 0.94
R8054:Vmn2r19 UTSW 6 123316039 missense probably damaging 1.00
R8074:Vmn2r19 UTSW 6 123335945 missense probably damaging 0.96
R8267:Vmn2r19 UTSW 6 123336262 missense possibly damaging 0.50
R8287:Vmn2r19 UTSW 6 123331629 missense probably damaging 1.00
R8937:Vmn2r19 UTSW 6 123316324 critical splice donor site probably null
R9058:Vmn2r19 UTSW 6 123336062 missense possibly damaging 0.53
R9119:Vmn2r19 UTSW 6 123315568 missense possibly damaging 0.68
R9384:Vmn2r19 UTSW 6 123315964 missense probably benign 0.00
X0058:Vmn2r19 UTSW 6 123308349 missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123308339 missense probably benign 0.02
Z1177:Vmn2r19 UTSW 6 123336077 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATTGGGATTTCACCACATTTCC -3'
(R):5'- ATTGCTACCTTCCATGGGAGAG -3'

Sequencing Primer
(F):5'- AGAGGATTATCATTTTCTGTTCGC -3'
(R):5'- AGGAGCCCGGAGTACACTTTTATC -3'
Posted On 2018-05-04