Incidental Mutation 'R6393:Zscan4b'
ID515878
Institutional Source Beutler Lab
Gene Symbol Zscan4b
Ensembl Gene ENSMUSG00000095339
Gene Namezinc finger and SCAN domain containing 4B
SynonymsEG665780
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6393 (G1)
Quality Score124.008
Status Not validated
Chromosome7
Chromosomal Location10900740-10905050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10900901 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 472 (I472V)
Ref Sequence ENSEMBL: ENSMUSP00000148157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168158] [ENSMUST00000210847]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168158
AA Change: I472V

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127301
Gene: ENSMUSG00000095339
AA Change: I472V

DomainStartEndE-ValueType
Pfam:SCAN 43 122 1.8e-17 PFAM
low complexity region 181 192 N/A INTRINSIC
ZnF_C2H2 394 416 2.75e-3 SMART
ZnF_C2H2 423 445 6.57e-1 SMART
ZnF_C2H2 451 473 7.26e-3 SMART
ZnF_C2H2 479 502 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210847
AA Change: I472V

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,382 Q14R possibly damaging Het
Adamts12 A G 15: 11,255,635 D430G probably damaging Het
Agxt2 T C 15: 10,393,808 probably null Het
Akirin1 T G 4: 123,743,531 Q87P possibly damaging Het
Ank2 G A 3: 126,929,757 R974C probably damaging Het
Arhgap23 A G 11: 97,463,672 I804V probably damaging Het
Arhgef28 A T 13: 97,994,019 L437Q possibly damaging Het
Atp8a2 G T 14: 59,773,755 Y967* probably null Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Ccdc80 T A 16: 45,096,465 V528D possibly damaging Het
Chd6 A G 2: 160,979,487 Y1296H probably damaging Het
Chst13 G A 6: 90,325,081 R28C possibly damaging Het
Clrn1 A G 3: 58,846,320 F207L probably damaging Het
Col12a1 T C 9: 79,655,485 T1772A probably damaging Het
Cubn T C 2: 13,355,680 T1744A probably benign Het
Dchs2 A G 3: 83,129,911 E655G probably damaging Het
Dnajb3 T A 1: 88,205,662 E6V possibly damaging Het
Dock5 G A 14: 67,822,602 P463S probably benign Het
Fancd2 T A 6: 113,578,413 C1128S probably benign Het
Fcrl5 G A 3: 87,448,327 G449E probably damaging Het
Frem2 G T 3: 53,585,640 N1818K possibly damaging Het
Gm21149 C A 5: 15,473,039 V187L possibly damaging Het
Gm8994 A G 6: 136,328,598 K19R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gstm7 A G 3: 107,930,826 probably null Het
Htr1b T A 9: 81,631,757 I266F probably benign Het
Jakmip3 T C 7: 139,019,171 I305T probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kifc5b T C 17: 26,921,842 C97R probably benign Het
Klhl30 A T 1: 91,361,190 H557L probably damaging Het
Lama3 T C 18: 12,479,756 V1199A probably benign Het
Lmbr1 A G 5: 29,254,294 L246P probably damaging Het
M6pr T C 6: 122,315,380 L178P possibly damaging Het
Med17 A G 9: 15,274,583 S212P probably damaging Het
Med23 T A 10: 24,873,476 S31T possibly damaging Het
Morc2b T G 17: 33,137,776 T341P probably damaging Het
Mre11a A G 9: 14,785,509 M1V probably null Het
Mrpl17 T C 7: 105,809,915 H158R probably benign Het
Mstn A G 1: 53,066,489 Q330R probably benign Het
Muc16 T A 9: 18,647,399 K2533* probably null Het
N4bp2 T C 5: 65,791,001 S325P possibly damaging Het
Nadk A G 4: 155,589,351 Y399C possibly damaging Het
Nbea A C 3: 56,091,119 L89R probably damaging Het
Ncoa1 A G 12: 4,278,181 F775L probably benign Het
Ndufa11 C A 17: 56,721,331 A70E probably damaging Het
Nfx1 A G 4: 40,976,851 Y175C possibly damaging Het
Olfr1121 A G 2: 87,371,565 N11S probably damaging Het
Olfr1419 A T 19: 11,870,727 L163Q probably damaging Het
Pcsk6 T C 7: 65,969,014 S443P probably damaging Het
Pcsk9 T C 4: 106,447,596 D425G probably benign Het
Pdcd1lg2 T A 19: 29,437,298 C42S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rbm46 G A 3: 82,863,955 T451M probably benign Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Rpl7l1 T C 17: 46,782,622 E4G probably benign Het
Rptn A G 3: 93,397,199 E613G probably benign Het
Sbk2 T C 7: 4,957,622 D183G probably damaging Het
Slc15a4 C T 5: 127,616,886 A162T probably benign Het
Slc30a4 A G 2: 122,686,046 W315R probably damaging Het
Slc39a14 G C 14: 70,309,813 F361L probably benign Het
Slc6a13 T C 6: 121,336,842 Y515H possibly damaging Het
Slitrk3 C A 3: 73,049,914 K508N possibly damaging Het
Stard4 T C 18: 33,205,225 D144G probably benign Het
Tlr9 T C 9: 106,224,937 F476L probably damaging Het
Tshz1 A T 18: 84,013,220 V1021D probably damaging Het
Vmn1r54 A T 6: 90,269,322 I73F probably benign Het
Vmn2r19 A C 6: 123,316,153 S385R possibly damaging Het
Xkr5 A G 8: 18,948,700 L34P probably damaging Het
Xpo4 A G 14: 57,638,313 V121A probably damaging Het
Zbtb40 T A 4: 136,984,866 H268L probably null Het
Zfp865 T C 7: 5,030,066 F350S probably damaging Het
Other mutations in Zscan4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4696001:Zscan4b UTSW 7 10902022 missense possibly damaging 0.77
R0628:Zscan4b UTSW 7 10901463 missense probably damaging 0.99
R2289:Zscan4b UTSW 7 10901862 critical splice donor site probably null
R3713:Zscan4b UTSW 7 10901891 missense probably benign 0.01
R6129:Zscan4b UTSW 7 10901888 missense probably benign 0.01
R7057:Zscan4b UTSW 7 10901709 nonsense probably null
R7312:Zscan4b UTSW 7 10900940 missense probably benign 0.00
R7383:Zscan4b UTSW 7 10904033 missense possibly damaging 0.92
R7412:Zscan4b UTSW 7 10900864 missense probably damaging 1.00
R7412:Zscan4b UTSW 7 10901893 missense probably benign 0.03
R7449:Zscan4b UTSW 7 10904058 missense possibly damaging 0.95
Z1177:Zscan4b UTSW 7 10901737 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGATAACTTTATATGCCCCTGTACAG -3'
(R):5'- AACATGCCAGGAGCCTTTC -3'

Sequencing Primer
(F):5'- CCTGTACAGGGGAATGCCAG -3'
(R):5'- GGAGCCTTTCATCCCACCAGAG -3'
Posted On2018-05-04