Incidental Mutation 'R6393:Tlr9'
ID 515888
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Name toll-like receptor 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R6393 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 106222598-106226883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106224937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 476 (F476L)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
AlphaFold Q9EQU3
PDB Structure Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000062241
AA Change: F476L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: F476L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,382 Q14R possibly damaging Het
Adamts12 A G 15: 11,255,635 D430G probably damaging Het
Agxt2 T C 15: 10,393,808 probably null Het
Akirin1 T G 4: 123,743,531 Q87P possibly damaging Het
Ank2 G A 3: 126,929,757 R974C probably damaging Het
Arhgap23 A G 11: 97,463,672 I804V probably damaging Het
Arhgef28 A T 13: 97,994,019 L437Q possibly damaging Het
Atp8a2 G T 14: 59,773,755 Y967* probably null Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Ccdc80 T A 16: 45,096,465 V528D possibly damaging Het
Chd6 A G 2: 160,979,487 Y1296H probably damaging Het
Chst13 G A 6: 90,325,081 R28C possibly damaging Het
Clrn1 A G 3: 58,846,320 F207L probably damaging Het
Col12a1 T C 9: 79,655,485 T1772A probably damaging Het
Cubn T C 2: 13,355,680 T1744A probably benign Het
Dchs2 A G 3: 83,129,911 E655G probably damaging Het
Dnajb3 T A 1: 88,205,662 E6V possibly damaging Het
Dock5 G A 14: 67,822,602 P463S probably benign Het
Fancd2 T A 6: 113,578,413 C1128S probably benign Het
Fcrl5 G A 3: 87,448,327 G449E probably damaging Het
Frem2 G T 3: 53,585,640 N1818K possibly damaging Het
Gm21149 C A 5: 15,473,039 V187L possibly damaging Het
Gm8994 A G 6: 136,328,598 K19R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gstm7 A G 3: 107,930,826 probably null Het
Htr1b T A 9: 81,631,757 I266F probably benign Het
Jakmip3 T C 7: 139,019,171 I305T probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kifc5b T C 17: 26,921,842 C97R probably benign Het
Klhl30 A T 1: 91,361,190 H557L probably damaging Het
Lama3 T C 18: 12,479,756 V1199A probably benign Het
Lmbr1 A G 5: 29,254,294 L246P probably damaging Het
M6pr T C 6: 122,315,380 L178P possibly damaging Het
Med17 A G 9: 15,274,583 S212P probably damaging Het
Med23 T A 10: 24,873,476 S31T possibly damaging Het
Morc2b T G 17: 33,137,776 T341P probably damaging Het
Mre11a A G 9: 14,785,509 M1V probably null Het
Mrpl17 T C 7: 105,809,915 H158R probably benign Het
Mstn A G 1: 53,066,489 Q330R probably benign Het
Muc16 T A 9: 18,647,399 K2533* probably null Het
N4bp2 T C 5: 65,791,001 S325P possibly damaging Het
Nadk A G 4: 155,589,351 Y399C possibly damaging Het
Nbea A C 3: 56,091,119 L89R probably damaging Het
Ncoa1 A G 12: 4,278,181 F775L probably benign Het
Ndufa11 C A 17: 56,721,331 A70E probably damaging Het
Nfx1 A G 4: 40,976,851 Y175C possibly damaging Het
Olfr1121 A G 2: 87,371,565 N11S probably damaging Het
Olfr1419 A T 19: 11,870,727 L163Q probably damaging Het
Pcsk6 T C 7: 65,969,014 S443P probably damaging Het
Pcsk9 T C 4: 106,447,596 D425G probably benign Het
Pdcd1lg2 T A 19: 29,437,298 C42S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rbm46 G A 3: 82,863,955 T451M probably benign Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Rpl7l1 T C 17: 46,782,622 E4G probably benign Het
Rptn A G 3: 93,397,199 E613G probably benign Het
Sbk2 T C 7: 4,957,622 D183G probably damaging Het
Slc15a4 C T 5: 127,616,886 A162T probably benign Het
Slc30a4 A G 2: 122,686,046 W315R probably damaging Het
Slc39a14 G C 14: 70,309,813 F361L probably benign Het
Slc6a13 T C 6: 121,336,842 Y515H possibly damaging Het
Slitrk3 C A 3: 73,049,914 K508N possibly damaging Het
Stard4 T C 18: 33,205,225 D144G probably benign Het
Tshz1 A T 18: 84,013,220 V1021D probably damaging Het
Vmn1r54 A T 6: 90,269,322 I73F probably benign Het
Vmn2r19 A C 6: 123,316,153 S385R possibly damaging Het
Xkr5 A G 8: 18,948,700 L34P probably damaging Het
Xpo4 A G 14: 57,638,313 V121A probably damaging Het
Zbtb40 T A 4: 136,984,866 H268L probably null Het
Zfp865 T C 7: 5,030,066 F350S probably damaging Het
Zscan4b T C 7: 10,900,901 I472V possibly damaging Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
R7385:Tlr9 UTSW 9 106225264 missense probably damaging 1.00
R7455:Tlr9 UTSW 9 106224530 missense probably benign 0.00
R7561:Tlr9 UTSW 9 106225949 missense probably benign 0.00
R8889:Tlr9 UTSW 9 106222635 start gained probably benign
R8892:Tlr9 UTSW 9 106222635 start gained probably benign
R8926:Tlr9 UTSW 9 106226014 missense probably benign
R9221:Tlr9 UTSW 9 106224773 missense probably damaging 1.00
R9228:Tlr9 UTSW 9 106225553 missense possibly damaging 0.49
Z1176:Tlr9 UTSW 9 106223663 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCACAGCTCAGCATCTTTGG -3'
(R):5'- CCAGTGGTACAAGTCCAGTTTG -3'

Sequencing Primer
(F):5'- AGCATCTTTGGTACCTTCCGAG -3'
(R):5'- ACAAGTCCAGTTTGTTATGGGACAG -3'
Posted On 2018-05-04