Incidental Mutation 'R6393:Ncoa1'
ID515891
Institutional Source Beutler Lab
Gene Symbol Ncoa1
Ensembl Gene ENSMUSG00000020647
Gene Namenuclear receptor coactivator 1
SynonymsbHLHe74, SRC-a/NCoA-1, KAT13A, SRC-1, SRC1, steroid receptor coactivator-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6393 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location4247362-4477182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4278181 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 775 (F775L)
Ref Sequence ENSEMBL: ENSMUSP00000151610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085814] [ENSMUST00000217674] [ENSMUST00000217794] [ENSMUST00000220434]
Predicted Effect probably benign
Transcript: ENSMUST00000085814
AA Change: F886L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082971
Gene: ENSMUSG00000020647
AA Change: F886L

DomainStartEndE-ValueType
HLH 29 86 1.73e-9 SMART
PAS 111 178 1.32e-10 SMART
Pfam:PAS_11 259 370 8e-37 PFAM
low complexity region 419 441 N/A INTRINSIC
Pfam:NCOA_u2 468 591 1.3e-29 PFAM
Pfam:SRC-1 632 712 3.5e-26 PFAM
low complexity region 724 736 N/A INTRINSIC
PDB:3RVF|B 747 767 1e-6 PDB
low complexity region 777 785 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
Pfam:Nuc_rec_co-act 930 977 2.3e-23 PFAM
low complexity region 1059 1080 N/A INTRINSIC
low complexity region 1125 1137 N/A INTRINSIC
DUF1518 1155 1211 7.47e-16 SMART
DUF1518 1218 1274 1.14e-11 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217674
AA Change: F775L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217794
AA Change: F886L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218191
Predicted Effect probably benign
Transcript: ENSMUST00000220434
AA Change: F886L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show osteopenia, increased serum sex hormone levels, altered bone remodeling and skeletal responses to sex hormones, and obesity. Homozygotes for another null allele show thyroid and steroid hormone resistance, delayed Purkinje cell development, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,382 Q14R possibly damaging Het
Adamts12 A G 15: 11,255,635 D430G probably damaging Het
Agxt2 T C 15: 10,393,808 probably null Het
Akirin1 T G 4: 123,743,531 Q87P possibly damaging Het
Ank2 G A 3: 126,929,757 R974C probably damaging Het
Arhgap23 A G 11: 97,463,672 I804V probably damaging Het
Arhgef28 A T 13: 97,994,019 L437Q possibly damaging Het
Atp8a2 G T 14: 59,773,755 Y967* probably null Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Ccdc80 T A 16: 45,096,465 V528D possibly damaging Het
Chd6 A G 2: 160,979,487 Y1296H probably damaging Het
Chst13 G A 6: 90,325,081 R28C possibly damaging Het
Clrn1 A G 3: 58,846,320 F207L probably damaging Het
Col12a1 T C 9: 79,655,485 T1772A probably damaging Het
Cubn T C 2: 13,355,680 T1744A probably benign Het
Dchs2 A G 3: 83,129,911 E655G probably damaging Het
Dnajb3 T A 1: 88,205,662 E6V possibly damaging Het
Dock5 G A 14: 67,822,602 P463S probably benign Het
Fancd2 T A 6: 113,578,413 C1128S probably benign Het
Fcrl5 G A 3: 87,448,327 G449E probably damaging Het
Frem2 G T 3: 53,585,640 N1818K possibly damaging Het
Gm21149 C A 5: 15,473,039 V187L possibly damaging Het
Gm8994 A G 6: 136,328,598 K19R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gstm7 A G 3: 107,930,826 probably null Het
Htr1b T A 9: 81,631,757 I266F probably benign Het
Jakmip3 T C 7: 139,019,171 I305T probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kifc5b T C 17: 26,921,842 C97R probably benign Het
Klhl30 A T 1: 91,361,190 H557L probably damaging Het
Lama3 T C 18: 12,479,756 V1199A probably benign Het
Lmbr1 A G 5: 29,254,294 L246P probably damaging Het
M6pr T C 6: 122,315,380 L178P possibly damaging Het
Med17 A G 9: 15,274,583 S212P probably damaging Het
Med23 T A 10: 24,873,476 S31T possibly damaging Het
Morc2b T G 17: 33,137,776 T341P probably damaging Het
Mre11a A G 9: 14,785,509 M1V probably null Het
Mrpl17 T C 7: 105,809,915 H158R probably benign Het
Mstn A G 1: 53,066,489 Q330R probably benign Het
Muc16 T A 9: 18,647,399 K2533* probably null Het
N4bp2 T C 5: 65,791,001 S325P possibly damaging Het
Nadk A G 4: 155,589,351 Y399C possibly damaging Het
Nbea A C 3: 56,091,119 L89R probably damaging Het
Ndufa11 C A 17: 56,721,331 A70E probably damaging Het
Nfx1 A G 4: 40,976,851 Y175C possibly damaging Het
Olfr1121 A G 2: 87,371,565 N11S probably damaging Het
Olfr1419 A T 19: 11,870,727 L163Q probably damaging Het
Pcsk6 T C 7: 65,969,014 S443P probably damaging Het
Pcsk9 T C 4: 106,447,596 D425G probably benign Het
Pdcd1lg2 T A 19: 29,437,298 C42S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rbm46 G A 3: 82,863,955 T451M probably benign Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Rpl7l1 T C 17: 46,782,622 E4G probably benign Het
Rptn A G 3: 93,397,199 E613G probably benign Het
Sbk2 T C 7: 4,957,622 D183G probably damaging Het
Slc15a4 C T 5: 127,616,886 A162T probably benign Het
Slc30a4 A G 2: 122,686,046 W315R probably damaging Het
Slc39a14 G C 14: 70,309,813 F361L probably benign Het
Slc6a13 T C 6: 121,336,842 Y515H possibly damaging Het
Slitrk3 C A 3: 73,049,914 K508N possibly damaging Het
Stard4 T C 18: 33,205,225 D144G probably benign Het
Tlr9 T C 9: 106,224,937 F476L probably damaging Het
Tshz1 A T 18: 84,013,220 V1021D probably damaging Het
Vmn1r54 A T 6: 90,269,322 I73F probably benign Het
Vmn2r19 A C 6: 123,316,153 S385R possibly damaging Het
Xkr5 A G 8: 18,948,700 L34P probably damaging Het
Xpo4 A G 14: 57,638,313 V121A probably damaging Het
Zbtb40 T A 4: 136,984,866 H268L probably null Het
Zfp865 T C 7: 5,030,066 F350S probably damaging Het
Zscan4b T C 7: 10,900,901 I472V possibly damaging Het
Other mutations in Ncoa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ncoa1 APN 12 4278218 missense probably benign
IGL01335:Ncoa1 APN 12 4297520 missense probably benign 0.31
IGL02111:Ncoa1 APN 12 4274944 start codon destroyed probably null
IGL02863:Ncoa1 APN 12 4297513 missense probably benign 0.00
IGL02967:Ncoa1 APN 12 4295294 missense probably damaging 1.00
IGL03007:Ncoa1 APN 12 4339114 missense possibly damaging 0.92
IGL03031:Ncoa1 APN 12 4274818 missense possibly damaging 0.76
IGL03048:Ncoa1 UTSW 12 4267922 missense probably damaging 0.96
IGL03147:Ncoa1 UTSW 12 4259342 missense probably damaging 1.00
PIT1430001:Ncoa1 UTSW 12 4323005 missense probably benign 0.19
PIT4402001:Ncoa1 UTSW 12 4294987 missense probably benign 0.00
R0002:Ncoa1 UTSW 12 4290885 missense probably benign 0.00
R0011:Ncoa1 UTSW 12 4322896 missense possibly damaging 0.94
R0389:Ncoa1 UTSW 12 4295976 missense probably benign 0.05
R0467:Ncoa1 UTSW 12 4267687 missense possibly damaging 0.49
R0480:Ncoa1 UTSW 12 4339105 missense probably damaging 1.00
R0541:Ncoa1 UTSW 12 4323033 missense probably damaging 1.00
R0671:Ncoa1 UTSW 12 4249758 splice site probably null
R1387:Ncoa1 UTSW 12 4274790 missense probably benign 0.01
R1426:Ncoa1 UTSW 12 4270737 splice site probably benign
R1538:Ncoa1 UTSW 12 4270748 missense possibly damaging 0.94
R1577:Ncoa1 UTSW 12 4295196 missense probably damaging 0.99
R1902:Ncoa1 UTSW 12 4339049 missense possibly damaging 0.78
R1905:Ncoa1 UTSW 12 4295433 missense probably damaging 1.00
R2026:Ncoa1 UTSW 12 4267647 missense probably benign 0.19
R2259:Ncoa1 UTSW 12 4315819 missense probably damaging 1.00
R2317:Ncoa1 UTSW 12 4275189 missense probably damaging 0.99
R3608:Ncoa1 UTSW 12 4278186 missense probably benign 0.00
R4042:Ncoa1 UTSW 12 4267871 missense probably damaging 0.99
R4688:Ncoa1 UTSW 12 4315781 missense probably benign 0.26
R4763:Ncoa1 UTSW 12 4275297 missense probably damaging 1.00
R4878:Ncoa1 UTSW 12 4275004 missense probably damaging 1.00
R5062:Ncoa1 UTSW 12 4259333 missense probably damaging 0.99
R5531:Ncoa1 UTSW 12 4253746 missense probably benign
R6711:Ncoa1 UTSW 12 4322904 missense probably benign 0.26
R7066:Ncoa1 UTSW 12 4322934 missense possibly damaging 0.90
R7109:Ncoa1 UTSW 12 4322978 missense possibly damaging 0.63
R7170:Ncoa1 UTSW 12 4249722 missense probably benign 0.32
R7395:Ncoa1 UTSW 12 4295188 missense not run
R7453:Ncoa1 UTSW 12 4259307 missense probably damaging 1.00
R7556:Ncoa1 UTSW 12 4270794 missense probably damaging 0.98
R7821:Ncoa1 UTSW 12 4296221 missense probably benign 0.00
R7872:Ncoa1 UTSW 12 4278186 missense probably benign 0.00
R7885:Ncoa1 UTSW 12 4339044 missense probably damaging 1.00
R7936:Ncoa1 UTSW 12 4335873 missense possibly damaging 0.53
R7940:Ncoa1 UTSW 12 4313095 missense possibly damaging 0.50
R8126:Ncoa1 UTSW 12 4290951 missense probably damaging 1.00
R8176:Ncoa1 UTSW 12 4267858 missense possibly damaging 0.90
R8510:Ncoa1 UTSW 12 4259303 missense probably benign
Z1177:Ncoa1 UTSW 12 4306514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATACTCGTGCACACTGGG -3'
(R):5'- GCACTTTCAGAGAGCTGCTAC -3'

Sequencing Primer
(F):5'- CTGGGATCCAGTCTGGGGAG -3'
(R):5'- GAAATCCTGCTCTCCTGT -3'
Posted On2018-05-04