Mutagenetix > Incidental Mutations

Incidental Mutation 'R6393:Arhgef28'

515893

Institutional Source

Beutler Lab

Gene Symbol

Arhgef28

Ensembl Gene

ENSMUSG00000021662

Gene Name

Rho guanine nucleotide exchange factor (GEF) 28

Synonyms

RhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6393 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97899469-98206439 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 97994019 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 437 (L437Q)

Ref Sequence

ENSEMBL: ENSMUSP00000153000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000223849] [ENSMUST00000225884]

Predicted Effect

probably benign
Transcript: ENSMUST00000109426
AA Change: L437Q

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: L437Q

Domain	Start	End	E-Value	Type
low complexity region	530	568	N/A	INTRINSIC
low complexity region	634	650	N/A	INTRINSIC
C1	652	698	1.65e-11	SMART
RhoGEF	850	1040	1.11e-65	SMART
PH	1084	1187	1.08e-9	SMART
low complexity region	1267	1281	N/A	INTRINSIC
coiled coil region	1469	1522	N/A	INTRINSIC
low complexity region	1647	1663	N/A	INTRINSIC
low complexity region	1682	1693	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223849
AA Change: L437Q

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224926

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225663

Predicted Effect

probably benign
Transcript: ENSMUST00000225884
AA Change: L437Q

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.8%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A130010J15Rik	A	G	1: 193,174,382	Q14R	possibly damaging	Het
Adamts12	A	G	15: 11,255,635	D430G	probably damaging	Het
Agxt2	T	C	15: 10,393,808		probably null	Het
Akirin1	T	G	4: 123,743,531	Q87P	possibly damaging	Het
Ank2	G	A	3: 126,929,757	R974C	probably damaging	Het
Arhgap23	A	G	11: 97,463,672	I804V	probably damaging	Het
Atp8a2	G	T	14: 59,773,755	Y967*	probably null	Het
Calcr	A	G	6: 3,708,586	L200S	probably damaging	Het
Ccdc80	T	A	16: 45,096,465	V528D	possibly damaging	Het
Chd6	A	G	2: 160,979,487	Y1296H	probably damaging	Het
Chst13	G	A	6: 90,325,081	R28C	possibly damaging	Het
Clrn1	A	G	3: 58,846,320	F207L	probably damaging	Het
Col12a1	T	C	9: 79,655,485	T1772A	probably damaging	Het
Cubn	T	C	2: 13,355,680	T1744A	probably benign	Het
Dchs2	A	G	3: 83,129,911	E655G	probably damaging	Het
Dnajb3	T	A	1: 88,205,662	E6V	possibly damaging	Het
Dock5	G	A	14: 67,822,602	P463S	probably benign	Het
Fancd2	T	A	6: 113,578,413	C1128S	probably benign	Het
Fcrl5	G	A	3: 87,448,327	G449E	probably damaging	Het
Frem2	G	T	3: 53,585,640	N1818K	possibly damaging	Het
Gm21149	C	A	5: 15,473,039	V187L	possibly damaging	Het
Gm8994	A	G	6: 136,328,598	K19R	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gstm7	A	G	3: 107,930,826		probably null	Het
Htr1b	T	A	9: 81,631,757	I266F	probably benign	Het
Jakmip3	T	C	7: 139,019,171	I305T	probably damaging	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Kifc5b	T	C	17: 26,921,842	C97R	probably benign	Het
Klhl30	A	T	1: 91,361,190	H557L	probably damaging	Het
Lama3	T	C	18: 12,479,756	V1199A	probably benign	Het
Lmbr1	A	G	5: 29,254,294	L246P	probably damaging	Het
M6pr	T	C	6: 122,315,380	L178P	possibly damaging	Het
Med17	A	G	9: 15,274,583	S212P	probably damaging	Het
Med23	T	A	10: 24,873,476	S31T	possibly damaging	Het
Morc2b	T	G	17: 33,137,776	T341P	probably damaging	Het
Mre11a	A	G	9: 14,785,509	M1V	probably null	Het
Mrpl17	T	C	7: 105,809,915	H158R	probably benign	Het
Mstn	A	G	1: 53,066,489	Q330R	probably benign	Het
Muc16	T	A	9: 18,647,399	K2533*	probably null	Het
N4bp2	T	C	5: 65,791,001	S325P	possibly damaging	Het
Nadk	A	G	4: 155,589,351	Y399C	possibly damaging	Het
Nbea	A	C	3: 56,091,119	L89R	probably damaging	Het
Ncoa1	A	G	12: 4,278,181	F775L	probably benign	Het
Ndufa11	C	A	17: 56,721,331	A70E	probably damaging	Het
Nfx1	A	G	4: 40,976,851	Y175C	possibly damaging	Het
Olfr1121	A	G	2: 87,371,565	N11S	probably damaging	Het
Olfr1419	A	T	19: 11,870,727	L163Q	probably damaging	Het
Pcsk6	T	C	7: 65,969,014	S443P	probably damaging	Het
Pcsk9	T	C	4: 106,447,596	D425G	probably benign	Het
Pdcd1lg2	T	A	19: 29,437,298	C42S	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Rbm46	G	A	3: 82,863,955	T451M	probably benign	Het
Rcan2	T	A	17: 43,953,479	V10D	probably benign	Het
Rpl7l1	T	C	17: 46,782,622	E4G	probably benign	Het
Rptn	A	G	3: 93,397,199	E613G	probably benign	Het
Sbk2	T	C	7: 4,957,622	D183G	probably damaging	Het
Slc15a4	C	T	5: 127,616,886	A162T	probably benign	Het
Slc30a4	A	G	2: 122,686,046	W315R	probably damaging	Het
Slc39a14	G	C	14: 70,309,813	F361L	probably benign	Het
Slc6a13	T	C	6: 121,336,842	Y515H	possibly damaging	Het
Slitrk3	C	A	3: 73,049,914	K508N	possibly damaging	Het
Stard4	T	C	18: 33,205,225	D144G	probably benign	Het
Tlr9	T	C	9: 106,224,937	F476L	probably damaging	Het
Tshz1	A	T	18: 84,013,220	V1021D	probably damaging	Het
Vmn1r54	A	T	6: 90,269,322	I73F	probably benign	Het
Vmn2r19	A	C	6: 123,316,153	S385R	possibly damaging	Het
Xkr5	A	G	8: 18,948,700	L34P	probably damaging	Het
Xpo4	A	G	14: 57,638,313	V121A	probably damaging	Het
Zbtb40	T	A	4: 136,984,866	H268L	probably null	Het
Zfp865	T	C	7: 5,030,066	F350S	probably damaging	Het
Zscan4b	T	C	7: 10,900,901	I472V	possibly damaging	Het

Other mutations in Arhgef28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Arhgef28	APN	13	97988277	missense	probably benign	0.15
IGL00945:Arhgef28	APN	13	97967399	missense	possibly damaging	0.88
IGL01099:Arhgef28	APN	13	97953972	splice site	probably benign
IGL01328:Arhgef28	APN	13	97970323	missense	probably damaging	1.00
IGL01396:Arhgef28	APN	13	97953893	missense	probably damaging	0.99
IGL02067:Arhgef28	APN	13	98077317	missense	probably damaging	1.00
IGL02147:Arhgef28	APN	13	97961314	missense	probably damaging	1.00
IGL02285:Arhgef28	APN	13	98051028	missense	possibly damaging	0.85
IGL02439:Arhgef28	APN	13	97931139	missense	possibly damaging	0.75
IGL02499:Arhgef28	APN	13	97953783	missense	possibly damaging	0.87
IGL02532:Arhgef28	APN	13	98029883	missense	probably damaging	0.99
IGL02634:Arhgef28	APN	13	98051058	missense	probably benign	0.00
IGL02902:Arhgef28	APN	13	97946875	missense	probably damaging	1.00
IGL03067:Arhgef28	APN	13	97988286	missense	probably benign	0.00
IGL03081:Arhgef28	APN	13	98029373	splice site	probably benign
IGL03106:Arhgef28	APN	13	97957793	missense	probably damaging	1.00
IGL03195:Arhgef28	APN	13	97951563	splice site	probably null
IGL03325:Arhgef28	APN	13	97899816	missense	probably benign	0.03
H8786:Arhgef28	UTSW	13	97946953	missense	probably damaging	1.00
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0027:Arhgef28	UTSW	13	97945696	missense	possibly damaging	0.94
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0062:Arhgef28	UTSW	13	97956642	missense	possibly damaging	0.56
R0090:Arhgef28	UTSW	13	98075110	missense	probably damaging	0.99
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0096:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0537:Arhgef28	UTSW	13	97957716	missense	probably damaging	1.00
R0617:Arhgef28	UTSW	13	97970355	missense	probably benign	0.21
R0711:Arhgef28	UTSW	13	97931254	missense	probably damaging	1.00
R0723:Arhgef28	UTSW	13	97939479	missense	probably benign	0.16
R0790:Arhgef28	UTSW	13	97981406	missense	possibly damaging	0.51
R1240:Arhgef28	UTSW	13	97929492	missense	probably benign	0.00
R1365:Arhgef28	UTSW	13	98075124	missense	probably damaging	1.00
R1456:Arhgef28	UTSW	13	98075002	missense	probably benign	0.01
R1490:Arhgef28	UTSW	13	97978444	missense	probably damaging	1.00
R1496:Arhgef28	UTSW	13	97965546	missense	possibly damaging	0.93
R1660:Arhgef28	UTSW	13	97981376	missense	probably benign	0.05
R1671:Arhgef28	UTSW	13	97931034	missense	possibly damaging	0.95
R1747:Arhgef28	UTSW	13	97936824	missense	probably damaging	1.00
R1792:Arhgef28	UTSW	13	97931186	missense	probably benign	0.03
R1864:Arhgef28	UTSW	13	97994132	missense	probably benign	0.00
R1887:Arhgef28	UTSW	13	98145573	missense	probably damaging	0.97
R1924:Arhgef28	UTSW	13	97936816	splice site	probably benign
R1987:Arhgef28	UTSW	13	97967096	missense	probably benign
R2215:Arhgef28	UTSW	13	98051021	missense	possibly damaging	0.78
R2342:Arhgef28	UTSW	13	97994029	missense	probably benign	0.00
R2495:Arhgef28	UTSW	13	98029373	splice site	probably benign
R3897:Arhgef28	UTSW	13	97956576	missense	probably damaging	1.00
R3922:Arhgef28	UTSW	13	97993944	missense	possibly damaging	0.92
R4063:Arhgef28	UTSW	13	97994067	missense	probably benign	0.16
R4086:Arhgef28	UTSW	13	97967204	missense	probably damaging	0.98
R4543:Arhgef28	UTSW	13	98075000	missense	probably benign	0.00
R4730:Arhgef28	UTSW	13	97978142	missense	probably benign	0.00
R4735:Arhgef28	UTSW	13	97899729	missense	probably damaging	1.00
R4953:Arhgef28	UTSW	13	97929554	missense	possibly damaging	0.51
R5069:Arhgef28	UTSW	13	98075206	missense	probably damaging	0.96
R5558:Arhgef28	UTSW	13	97961460	missense	probably damaging	1.00
R5573:Arhgef28	UTSW	13	97929491	missense	probably benign	0.01
R5594:Arhgef28	UTSW	13	97939492	missense	probably benign	0.00
R5937:Arhgef28	UTSW	13	97939543	missense	probably benign	0.00
R5987:Arhgef28	UTSW	13	97936860	nonsense	probably null
R6015:Arhgef28	UTSW	13	98075022	missense	possibly damaging	0.73
R6193:Arhgef28	UTSW	13	97985380	missense	probably damaging	1.00
R6209:Arhgef28	UTSW	13	97929409	critical splice donor site	probably null
R6306:Arhgef28	UTSW	13	97985388	missense	probably damaging	1.00
R6562:Arhgef28	UTSW	13	97988139	critical splice donor site	probably null
R6646:Arhgef28	UTSW	13	97939494	missense	probably benign	0.09
R6655:Arhgef28	UTSW	13	97899655	missense	probably damaging	1.00
R6707:Arhgef28	UTSW	13	97936716	missense	probably damaging	0.96
R6707:Arhgef28	UTSW	13	98075116	missense	possibly damaging	0.80
R6751:Arhgef28	UTSW	13	98075247	missense	probably damaging	0.97
R6940:Arhgef28	UTSW	13	97965530	missense	possibly damaging	0.58
R7018:Arhgef28	UTSW	13	97965435	missense	probably damaging	1.00
R7030:Arhgef28	UTSW	13	97988261	missense	possibly damaging	0.88
R7120:Arhgef28	UTSW	13	97944539	missense	probably damaging	1.00
R7266:Arhgef28	UTSW	13	97965452	missense	probably benign
R7353:Arhgef28	UTSW	13	98075202	missense	probably damaging	1.00
R7368:Arhgef28	UTSW	13	97996862	missense	probably benign	0.34
R7491:Arhgef28	UTSW	13	97944686	missense	probably benign	0.03
R7500:Arhgef28	UTSW	13	97978495	missense	probably benign	0.00
R7653:Arhgef28	UTSW	13	97969313	missense	probably benign	0.04
R7813:Arhgef28	UTSW	13	97945681	missense	possibly damaging	0.48
Z1088:Arhgef28	UTSW	13	97945691	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGGCAACGTTTTGATATAGAC -3'
(R):5'- ATTCTCTTCCAACGTCCAGG -3'

Sequencing Primer
(F):5'- GGGGCAGGTTTTAAAATGAAACTTTC -3'
(R):5'- CCAGGTTGGCGATTTGGATATCAAC -3'

Posted On

2018-05-04