Mutagenetix > Incidental Mutation

Incidental Mutation 'R6393:Atp8a2'

515895

Institutional Source

Beutler Lab

Gene Symbol

Atp8a2

Ensembl Gene

ENSMUSG00000021983

Gene Name

ATPase, aminophospholipid transporter-like, class I, type 8A, member 2

Synonyms

wl, Ib

MMRRC Submission

044542-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.416) question?

Stock #

R6393 (G1)

Quality Score

166.009

Status

Validated

Chromosome

Chromosomal Location

59638540-60197179 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 59773755 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 967 (Y967*)

Ref Sequence

ENSEMBL: ENSMUSP00000079238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080368]

AlphaFold

P98200

Predicted Effect

probably null
Transcript: ENSMUST00000080368
AA Change: Y967*

SMART Domains

Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: Y967*

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	14	80	2.3e-27	PFAM
Pfam:E1-E2_ATPase	85	348	6.7e-15	PFAM
Pfam:HAD	385	790	3.2e-22	PFAM
Pfam:Cation_ATPase	465	564	3.2e-14	PFAM
Pfam:PhoLip_ATPase_C	807	1059	2.8e-79	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.8%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A130010J15Rik	A	G	1: 193,174,382	Q14R	possibly damaging	Het
Adamts12	A	G	15: 11,255,635	D430G	probably damaging	Het
Agxt2	T	C	15: 10,393,808		probably null	Het
Akirin1	T	G	4: 123,743,531	Q87P	possibly damaging	Het
Ank2	G	A	3: 126,929,757	R974C	probably damaging	Het
Arhgap23	A	G	11: 97,463,672	I804V	probably damaging	Het
Arhgef28	A	T	13: 97,994,019	L437Q	possibly damaging	Het
Calcr	A	G	6: 3,708,586	L200S	probably damaging	Het
Ccdc80	T	A	16: 45,096,465	V528D	possibly damaging	Het
Chd6	A	G	2: 160,979,487	Y1296H	probably damaging	Het
Chst13	G	A	6: 90,325,081	R28C	possibly damaging	Het
Clrn1	A	G	3: 58,846,320	F207L	probably damaging	Het
Col12a1	T	C	9: 79,655,485	T1772A	probably damaging	Het
Cubn	T	C	2: 13,355,680	T1744A	probably benign	Het
Dchs2	A	G	3: 83,129,911	E655G	probably damaging	Het
Dnajb3	T	A	1: 88,205,662	E6V	possibly damaging	Het
Dock5	G	A	14: 67,822,602	P463S	probably benign	Het
Fancd2	T	A	6: 113,578,413	C1128S	probably benign	Het
Fcrl5	G	A	3: 87,448,327	G449E	probably damaging	Het
Frem2	G	T	3: 53,585,640	N1818K	possibly damaging	Het
Gm21149	C	A	5: 15,473,039	V187L	possibly damaging	Het
Gm8994	A	G	6: 136,328,598	K19R	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gstm7	A	G	3: 107,930,826		probably null	Het
Htr1b	T	A	9: 81,631,757	I266F	probably benign	Het
Jakmip3	T	C	7: 139,019,171	I305T	probably damaging	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Kifc5b	T	C	17: 26,921,842	C97R	probably benign	Het
Klhl30	A	T	1: 91,361,190	H557L	probably damaging	Het
Lama3	T	C	18: 12,479,756	V1199A	probably benign	Het
Lmbr1	A	G	5: 29,254,294	L246P	probably damaging	Het
M6pr	T	C	6: 122,315,380	L178P	possibly damaging	Het
Med17	A	G	9: 15,274,583	S212P	probably damaging	Het
Med23	T	A	10: 24,873,476	S31T	possibly damaging	Het
Morc2b	T	G	17: 33,137,776	T341P	probably damaging	Het
Mre11a	A	G	9: 14,785,509	M1V	probably null	Het
Mrpl17	T	C	7: 105,809,915	H158R	probably benign	Het
Mstn	A	G	1: 53,066,489	Q330R	probably benign	Het
Muc16	T	A	9: 18,647,399	K2533*	probably null	Het
N4bp2	T	C	5: 65,791,001	S325P	possibly damaging	Het
Nadk	A	G	4: 155,589,351	Y399C	possibly damaging	Het
Nbea	A	C	3: 56,091,119	L89R	probably damaging	Het
Ncoa1	A	G	12: 4,278,181	F775L	probably benign	Het
Ndufa11	C	A	17: 56,721,331	A70E	probably damaging	Het
Nfx1	A	G	4: 40,976,851	Y175C	possibly damaging	Het
Olfr1121	A	G	2: 87,371,565	N11S	probably damaging	Het
Olfr1419	A	T	19: 11,870,727	L163Q	probably damaging	Het
Pcsk6	T	C	7: 65,969,014	S443P	probably damaging	Het
Pcsk9	T	C	4: 106,447,596	D425G	probably benign	Het
Pdcd1lg2	T	A	19: 29,437,298	C42S	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Rbm46	G	A	3: 82,863,955	T451M	probably benign	Het
Rcan2	T	A	17: 43,953,479	V10D	probably benign	Het
Rpl7l1	T	C	17: 46,782,622	E4G	probably benign	Het
Rptn	A	G	3: 93,397,199	E613G	probably benign	Het
Sbk2	T	C	7: 4,957,622	D183G	probably damaging	Het
Slc15a4	C	T	5: 127,616,886	A162T	probably benign	Het
Slc30a4	A	G	2: 122,686,046	W315R	probably damaging	Het
Slc39a14	G	C	14: 70,309,813	F361L	probably benign	Het
Slc6a13	T	C	6: 121,336,842	Y515H	possibly damaging	Het
Slitrk3	C	A	3: 73,049,914	K508N	possibly damaging	Het
Stard4	T	C	18: 33,205,225	D144G	probably benign	Het
Tlr9	T	C	9: 106,224,937	F476L	probably damaging	Het
Tshz1	A	T	18: 84,013,220	V1021D	probably damaging	Het
Vmn1r54	A	T	6: 90,269,322	I73F	probably benign	Het
Vmn2r19	A	C	6: 123,316,153	S385R	possibly damaging	Het
Xkr5	A	G	8: 18,948,700	L34P	probably damaging	Het
Xpo4	A	G	14: 57,638,313	V121A	probably damaging	Het
Zbtb40	T	A	4: 136,984,866	H268L	probably null	Het
Zfp865	T	C	7: 5,030,066	F350S	probably damaging	Het
Zscan4b	T	C	7: 10,900,901	I472V	possibly damaging	Het

Other mutations in Atp8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Atp8a2	APN	14	59691461	missense	probably benign	0.00
IGL01505:Atp8a2	APN	14	60028063	missense	probably benign	0.00
IGL01614:Atp8a2	APN	14	60044988	missense	probably damaging	0.99
IGL01621:Atp8a2	APN	14	60015868	splice site	probably benign
IGL01634:Atp8a2	APN	14	59998062	missense	probably benign	0.01
IGL01672:Atp8a2	APN	14	59691533	missense	probably benign	0.01
IGL01898:Atp8a2	APN	14	60023513	missense	probably damaging	1.00
IGL01945:Atp8a2	APN	14	60026160	missense	probably damaging	1.00
IGL02006:Atp8a2	APN	14	59857048	missense	possibly damaging	0.90
IGL02089:Atp8a2	APN	14	60026920	splice site	probably null
IGL02211:Atp8a2	APN	14	60027976	missense	probably benign	0.00
IGL02283:Atp8a2	APN	14	60016799	missense	possibly damaging	0.86
IGL02337:Atp8a2	APN	14	59998002	missense	probably benign	0.32
IGL02571:Atp8a2	APN	14	60012458	splice site	probably benign
IGL02795:Atp8a2	APN	14	60033742	missense	probably damaging	0.96
IGL02874:Atp8a2	APN	14	59802252	missense	probably damaging	1.00
IGL02999:Atp8a2	APN	14	59925122	nonsense	probably null
IGL03307:Atp8a2	APN	14	60015872	critical splice donor site	probably null
IGL03345:Atp8a2	APN	14	59774011	missense	probably benign
PIT4431001:Atp8a2	UTSW	14	59654626	missense	probably benign
R0334:Atp8a2	UTSW	14	59691512	missense	probably damaging	1.00
R0368:Atp8a2	UTSW	14	59860212	missense	probably damaging	1.00
R0420:Atp8a2	UTSW	14	59773744	missense	probably damaging	1.00
R0684:Atp8a2	UTSW	14	60023144	missense	probably benign	0.00
R0755:Atp8a2	UTSW	14	60009881	missense	possibly damaging	0.96
R0853:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0908:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0991:Atp8a2	UTSW	14	59793929	missense	probably benign	0.33
R1025:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1190:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1387:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1426:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1442:Atp8a2	UTSW	14	59860323	splice site	probably benign
R1472:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1538:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1573:Atp8a2	UTSW	14	59860206	missense	probably benign	0.00
R1620:Atp8a2	UTSW	14	59791183	missense	probably benign
R1661:Atp8a2	UTSW	14	59860186	missense	possibly damaging	0.80
R1673:Atp8a2	UTSW	14	59791240	missense	probably benign	0.00
R1749:Atp8a2	UTSW	14	59860174	nonsense	probably null
R1796:Atp8a2	UTSW	14	60020758	critical splice donor site	probably null
R1815:Atp8a2	UTSW	14	60086624	missense	probably damaging	1.00
R1836:Atp8a2	UTSW	14	60006366	missense	possibly damaging	0.49
R1935:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1936:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1937:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R2416:Atp8a2	UTSW	14	59925008	missense	probably damaging	1.00
R2760:Atp8a2	UTSW	14	59860192	missense	probably benign	0.43
R3029:Atp8a2	UTSW	14	59691465	frame shift	probably null
R3621:Atp8a2	UTSW	14	60026138	splice site	probably null
R3768:Atp8a2	UTSW	14	60044336	missense	probably benign	0.19
R3784:Atp8a2	UTSW	14	59773966	missense	probably damaging	1.00
R3896:Atp8a2	UTSW	14	60026140	critical splice donor site	probably null
R4009:Atp8a2	UTSW	14	60027985	missense	possibly damaging	0.54
R4591:Atp8a2	UTSW	14	59654629	missense	probably benign	0.03
R4866:Atp8a2	UTSW	14	59691467	missense	probably damaging	1.00
R4879:Atp8a2	UTSW	14	60008469	nonsense	probably null
R5059:Atp8a2	UTSW	14	59691537	missense	probably benign	0.00
R5529:Atp8a2	UTSW	14	59793865	critical splice donor site	probably null
R5788:Atp8a2	UTSW	14	60020793	missense	probably damaging	0.96
R6126:Atp8a2	UTSW	14	60044326	missense	probably benign
R6295:Atp8a2	UTSW	14	60012399	nonsense	probably null
R6454:Atp8a2	UTSW	14	60008499	splice site	probably null
R6651:Atp8a2	UTSW	14	59774021	missense	probably benign	0.00
R6763:Atp8a2	UTSW	14	60008408	missense	probably benign	0.12
R6767:Atp8a2	UTSW	14	60046722	missense	probably damaging	1.00
R6912:Atp8a2	UTSW	14	60012410	missense	probably benign	0.33
R7032:Atp8a2	UTSW	14	60017840	splice site	probably null
R7243:Atp8a2	UTSW	14	59647842	missense	probably benign
R7352:Atp8a2	UTSW	14	59791204	missense	probably benign
R7355:Atp8a2	UTSW	14	60045004	missense	possibly damaging	0.65
R7382:Atp8a2	UTSW	14	59654594	missense	probably benign	0.00
R7451:Atp8a2	UTSW	14	59791181	missense	probably null	0.00
R7483:Atp8a2	UTSW	14	60008375	missense	probably benign	0.00
R7516:Atp8a2	UTSW	14	59857067	missense	probably damaging	1.00
R7831:Atp8a2	UTSW	14	59773753	missense	probably damaging	0.99
R8116:Atp8a2	UTSW	14	60026208	missense	probably damaging	1.00
R8171:Atp8a2	UTSW	14	60046044	missense	probably damaging	1.00
R8504:Atp8a2	UTSW	14	59647917	nonsense	probably null
R8516:Atp8a2	UTSW	14	59691472	missense	probably benign	0.00
R8552:Atp8a2	UTSW	14	59773982	missense	probably benign	0.00
R8852:Atp8a2	UTSW	14	59925096	missense	probably damaging	1.00
R9367:Atp8a2	UTSW	14	60012378	critical splice donor site	probably null
R9469:Atp8a2	UTSW	14	59791219	missense	probably benign	0.32
R9691:Atp8a2	UTSW	14	60008380	missense	probably damaging	0.96
R9709:Atp8a2	UTSW	14	60033738	missense	probably damaging	0.98
Z1088:Atp8a2	UTSW	14	60027970	missense	probably benign
Z1177:Atp8a2	UTSW	14	60006330	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GGCAGTAGGTGAGACTGAATCC -3'
(R):5'- CACACGTGGATTATACCTCCC -3'

Sequencing Primer
(F):5'- GTGAGACTGAATCCCAAATTGGCC -3'
(R):5'- GTGGATTATACCTCCCTAGATATGC -3'

Posted On

2018-05-04