Mutagenetix > Incidental Mutation

Incidental Mutation 'R6393:Adamts12'

515899

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6393 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11255635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 430 (D430G)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably damaging
Transcript: ENSMUST00000061318
AA Change: D430G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: D430G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.8%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A130010J15Rik	A	G	1: 193,174,382	Q14R	possibly damaging	Het
Agxt2	T	C	15: 10,393,808		probably null	Het
Akirin1	T	G	4: 123,743,531	Q87P	possibly damaging	Het
Ank2	G	A	3: 126,929,757	R974C	probably damaging	Het
Arhgap23	A	G	11: 97,463,672	I804V	probably damaging	Het
Arhgef28	A	T	13: 97,994,019	L437Q	possibly damaging	Het
Atp8a2	G	T	14: 59,773,755	Y967*	probably null	Het
Calcr	A	G	6: 3,708,586	L200S	probably damaging	Het
Ccdc80	T	A	16: 45,096,465	V528D	possibly damaging	Het
Chd6	A	G	2: 160,979,487	Y1296H	probably damaging	Het
Chst13	G	A	6: 90,325,081	R28C	possibly damaging	Het
Clrn1	A	G	3: 58,846,320	F207L	probably damaging	Het
Col12a1	T	C	9: 79,655,485	T1772A	probably damaging	Het
Cubn	T	C	2: 13,355,680	T1744A	probably benign	Het
Dchs2	A	G	3: 83,129,911	E655G	probably damaging	Het
Dnajb3	T	A	1: 88,205,662	E6V	possibly damaging	Het
Dock5	G	A	14: 67,822,602	P463S	probably benign	Het
Fancd2	T	A	6: 113,578,413	C1128S	probably benign	Het
Fcrl5	G	A	3: 87,448,327	G449E	probably damaging	Het
Frem2	G	T	3: 53,585,640	N1818K	possibly damaging	Het
Gm21149	C	A	5: 15,473,039	V187L	possibly damaging	Het
Gm8994	A	G	6: 136,328,598	K19R	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gstm7	A	G	3: 107,930,826		probably null	Het
Htr1b	T	A	9: 81,631,757	I266F	probably benign	Het
Jakmip3	T	C	7: 139,019,171	I305T	probably damaging	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Kifc5b	T	C	17: 26,921,842	C97R	probably benign	Het
Klhl30	A	T	1: 91,361,190	H557L	probably damaging	Het
Lama3	T	C	18: 12,479,756	V1199A	probably benign	Het
Lmbr1	A	G	5: 29,254,294	L246P	probably damaging	Het
M6pr	T	C	6: 122,315,380	L178P	possibly damaging	Het
Med17	A	G	9: 15,274,583	S212P	probably damaging	Het
Med23	T	A	10: 24,873,476	S31T	possibly damaging	Het
Morc2b	T	G	17: 33,137,776	T341P	probably damaging	Het
Mre11a	A	G	9: 14,785,509	M1V	probably null	Het
Mrpl17	T	C	7: 105,809,915	H158R	probably benign	Het
Mstn	A	G	1: 53,066,489	Q330R	probably benign	Het
Muc16	T	A	9: 18,647,399	K2533*	probably null	Het
N4bp2	T	C	5: 65,791,001	S325P	possibly damaging	Het
Nadk	A	G	4: 155,589,351	Y399C	possibly damaging	Het
Nbea	A	C	3: 56,091,119	L89R	probably damaging	Het
Ncoa1	A	G	12: 4,278,181	F775L	probably benign	Het
Ndufa11	C	A	17: 56,721,331	A70E	probably damaging	Het
Nfx1	A	G	4: 40,976,851	Y175C	possibly damaging	Het
Olfr1121	A	G	2: 87,371,565	N11S	probably damaging	Het
Olfr1419	A	T	19: 11,870,727	L163Q	probably damaging	Het
Pcsk6	T	C	7: 65,969,014	S443P	probably damaging	Het
Pcsk9	T	C	4: 106,447,596	D425G	probably benign	Het
Pdcd1lg2	T	A	19: 29,437,298	C42S	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Rbm46	G	A	3: 82,863,955	T451M	probably benign	Het
Rcan2	T	A	17: 43,953,479	V10D	probably benign	Het
Rpl7l1	T	C	17: 46,782,622	E4G	probably benign	Het
Rptn	A	G	3: 93,397,199	E613G	probably benign	Het
Sbk2	T	C	7: 4,957,622	D183G	probably damaging	Het
Slc15a4	C	T	5: 127,616,886	A162T	probably benign	Het
Slc30a4	A	G	2: 122,686,046	W315R	probably damaging	Het
Slc39a14	G	C	14: 70,309,813	F361L	probably benign	Het
Slc6a13	T	C	6: 121,336,842	Y515H	possibly damaging	Het
Slitrk3	C	A	3: 73,049,914	K508N	possibly damaging	Het
Stard4	T	C	18: 33,205,225	D144G	probably benign	Het
Tlr9	T	C	9: 106,224,937	F476L	probably damaging	Het
Tshz1	A	T	18: 84,013,220	V1021D	probably damaging	Het
Vmn1r54	A	T	6: 90,269,322	I73F	probably benign	Het
Vmn2r19	A	C	6: 123,316,153	S385R	possibly damaging	Het
Xkr5	A	G	8: 18,948,700	L34P	probably damaging	Het
Xpo4	A	G	14: 57,638,313	V121A	probably damaging	Het
Zbtb40	T	A	4: 136,984,866	H268L	probably null	Het
Zfp865	T	C	7: 5,030,066	F350S	probably damaging	Het
Zscan4b	T	C	7: 10,900,901	I472V	possibly damaging	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- AAGTGGCTTCCTGTGCTTTTAATC -3'
(R):5'- TTGCTCACTTGCCTGTAGAGG -3'

Sequencing Primer
(F):5'- GCTTCCTGTGCTTTTAATCGCTTTAG -3'
(R):5'- CTCACTTGCCTGTAGAGGTAGGAAG -3'

Posted On

2018-05-04