Incidental Mutation 'R6393:Adamts12'
ID 515899
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
MMRRC Submission 044542-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6393 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11255721 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 430 (D430G)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably damaging
Transcript: ENSMUST00000061318
AA Change: D430G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: D430G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 192,856,690 (GRCm39) Q14R possibly damaging Het
Agxt2 T C 15: 10,393,894 (GRCm39) probably null Het
Akirin1 T G 4: 123,637,324 (GRCm39) Q87P possibly damaging Het
Ank2 G A 3: 126,723,406 (GRCm39) R974C probably damaging Het
Arhgap23 A G 11: 97,354,498 (GRCm39) I804V probably damaging Het
Arhgef28 A T 13: 98,130,527 (GRCm39) L437Q possibly damaging Het
Atp8a2 G T 14: 60,011,204 (GRCm39) Y967* probably null Het
Calcr A G 6: 3,708,586 (GRCm39) L200S probably damaging Het
Ccdc80 T A 16: 44,916,828 (GRCm39) V528D possibly damaging Het
Chd6 A G 2: 160,821,407 (GRCm39) Y1296H probably damaging Het
Chst13 G A 6: 90,302,063 (GRCm39) R28C possibly damaging Het
Clrn1 A G 3: 58,753,741 (GRCm39) F207L probably damaging Het
Col12a1 T C 9: 79,562,767 (GRCm39) T1772A probably damaging Het
Cubn T C 2: 13,360,491 (GRCm39) T1744A probably benign Het
Dchs2 A G 3: 83,037,218 (GRCm39) E655G probably damaging Het
Dnajb3 T A 1: 88,133,384 (GRCm39) E6V possibly damaging Het
Dock5 G A 14: 68,060,051 (GRCm39) P463S probably benign Het
Eif4a3l1 A G 6: 136,305,596 (GRCm39) K19R probably benign Het
Fancd2 T A 6: 113,555,374 (GRCm39) C1128S probably benign Het
Fcrl5 G A 3: 87,355,634 (GRCm39) G449E probably damaging Het
Frem2 G T 3: 53,493,061 (GRCm39) N1818K possibly damaging Het
Gm21149 C A 5: 15,678,037 (GRCm39) V187L possibly damaging Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Gstm7 A G 3: 107,838,142 (GRCm39) probably null Het
Htr1b T A 9: 81,513,810 (GRCm39) I266F probably benign Het
Jakmip3 T C 7: 138,620,900 (GRCm39) I305T probably damaging Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Kifc5b T C 17: 27,140,816 (GRCm39) C97R probably benign Het
Klhl30 A T 1: 91,288,912 (GRCm39) H557L probably damaging Het
Lama3 T C 18: 12,612,813 (GRCm39) V1199A probably benign Het
Lmbr1 A G 5: 29,459,292 (GRCm39) L246P probably damaging Het
M6pr T C 6: 122,292,339 (GRCm39) L178P possibly damaging Het
Med17 A G 9: 15,185,879 (GRCm39) S212P probably damaging Het
Med23 T A 10: 24,749,374 (GRCm39) S31T possibly damaging Het
Morc2b T G 17: 33,356,750 (GRCm39) T341P probably damaging Het
Mre11a A G 9: 14,696,805 (GRCm39) M1V probably null Het
Mrpl17 T C 7: 105,459,122 (GRCm39) H158R probably benign Het
Mstn A G 1: 53,105,648 (GRCm39) Q330R probably benign Het
Muc16 T A 9: 18,558,695 (GRCm39) K2533* probably null Het
N4bp2 T C 5: 65,948,344 (GRCm39) S325P possibly damaging Het
Nadk A G 4: 155,673,808 (GRCm39) Y399C possibly damaging Het
Nbea A C 3: 55,998,540 (GRCm39) L89R probably damaging Het
Ncoa1 A G 12: 4,328,181 (GRCm39) F775L probably benign Het
Ndufa11 C A 17: 57,028,331 (GRCm39) A70E probably damaging Het
Nfx1 A G 4: 40,976,851 (GRCm39) Y175C possibly damaging Het
Or10q3 A T 19: 11,848,091 (GRCm39) L163Q probably damaging Het
Or12e9 A G 2: 87,201,909 (GRCm39) N11S probably damaging Het
Pcsk6 T C 7: 65,618,762 (GRCm39) S443P probably damaging Het
Pcsk9 T C 4: 106,304,793 (GRCm39) D425G probably benign Het
Pdcd1lg2 T A 19: 29,414,698 (GRCm39) C42S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Rbm46 G A 3: 82,771,262 (GRCm39) T451M probably benign Het
Rcan2 T A 17: 44,264,370 (GRCm39) V10D probably benign Het
Rpl7l1 T C 17: 47,093,548 (GRCm39) E4G probably benign Het
Rptn A G 3: 93,304,506 (GRCm39) E613G probably benign Het
Sbk2 T C 7: 4,960,621 (GRCm39) D183G probably damaging Het
Slc15a4 C T 5: 127,693,950 (GRCm39) A162T probably benign Het
Slc30a4 A G 2: 122,527,966 (GRCm39) W315R probably damaging Het
Slc39a14 G C 14: 70,547,262 (GRCm39) F361L probably benign Het
Slc6a13 T C 6: 121,313,801 (GRCm39) Y515H possibly damaging Het
Slitrk3 C A 3: 72,957,247 (GRCm39) K508N possibly damaging Het
Stard4 T C 18: 33,338,278 (GRCm39) D144G probably benign Het
Tlr9 T C 9: 106,102,136 (GRCm39) F476L probably damaging Het
Tshz1 A T 18: 84,031,345 (GRCm39) V1021D probably damaging Het
Vmn1r54 A T 6: 90,246,304 (GRCm39) I73F probably benign Het
Vmn2r19 A C 6: 123,293,112 (GRCm39) S385R possibly damaging Het
Xkr5 A G 8: 18,998,716 (GRCm39) L34P probably damaging Het
Xpo4 A G 14: 57,875,770 (GRCm39) V121A probably damaging Het
Zbtb40 T A 4: 136,712,177 (GRCm39) H268L probably null Het
Zfp865 T C 7: 5,033,065 (GRCm39) F350S probably damaging Het
Zscan4b T C 7: 10,634,828 (GRCm39) I472V possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGCTTCCTGTGCTTTTAATC -3'
(R):5'- TTGCTCACTTGCCTGTAGAGG -3'

Sequencing Primer
(F):5'- GCTTCCTGTGCTTTTAATCGCTTTAG -3'
(R):5'- CTCACTTGCCTGTAGAGGTAGGAAG -3'
Posted On 2018-05-04