Incidental Mutation 'R6393:Adamts12'
ID515899
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
SynonymsAI605170; ADAMTS-12
MMRRC Submission
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6393 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location11064790-11349231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11255635 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 430 (D430G)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
Predicted Effect probably damaging
Transcript: ENSMUST00000061318
AA Change: D430G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: D430G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,382 Q14R possibly damaging Het
Agxt2 T C 15: 10,393,808 probably null Het
Akirin1 T G 4: 123,743,531 Q87P possibly damaging Het
Ank2 G A 3: 126,929,757 R974C probably damaging Het
Arhgap23 A G 11: 97,463,672 I804V probably damaging Het
Arhgef28 A T 13: 97,994,019 L437Q possibly damaging Het
Atp8a2 G T 14: 59,773,755 Y967* probably null Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Ccdc80 T A 16: 45,096,465 V528D possibly damaging Het
Chd6 A G 2: 160,979,487 Y1296H probably damaging Het
Chst13 G A 6: 90,325,081 R28C possibly damaging Het
Clrn1 A G 3: 58,846,320 F207L probably damaging Het
Col12a1 T C 9: 79,655,485 T1772A probably damaging Het
Cubn T C 2: 13,355,680 T1744A probably benign Het
Dchs2 A G 3: 83,129,911 E655G probably damaging Het
Dnajb3 T A 1: 88,205,662 E6V possibly damaging Het
Dock5 G A 14: 67,822,602 P463S probably benign Het
Fancd2 T A 6: 113,578,413 C1128S probably benign Het
Fcrl5 G A 3: 87,448,327 G449E probably damaging Het
Frem2 G T 3: 53,585,640 N1818K possibly damaging Het
Gm21149 C A 5: 15,473,039 V187L possibly damaging Het
Gm8994 A G 6: 136,328,598 K19R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gstm7 A G 3: 107,930,826 probably null Het
Htr1b T A 9: 81,631,757 I266F probably benign Het
Jakmip3 T C 7: 139,019,171 I305T probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kifc5b T C 17: 26,921,842 C97R probably benign Het
Klhl30 A T 1: 91,361,190 H557L probably damaging Het
Lama3 T C 18: 12,479,756 V1199A probably benign Het
Lmbr1 A G 5: 29,254,294 L246P probably damaging Het
M6pr T C 6: 122,315,380 L178P possibly damaging Het
Med17 A G 9: 15,274,583 S212P probably damaging Het
Med23 T A 10: 24,873,476 S31T possibly damaging Het
Morc2b T G 17: 33,137,776 T341P probably damaging Het
Mre11a A G 9: 14,785,509 M1V probably null Het
Mrpl17 T C 7: 105,809,915 H158R probably benign Het
Mstn A G 1: 53,066,489 Q330R probably benign Het
Muc16 T A 9: 18,647,399 K2533* probably null Het
N4bp2 T C 5: 65,791,001 S325P possibly damaging Het
Nadk A G 4: 155,589,351 Y399C possibly damaging Het
Nbea A C 3: 56,091,119 L89R probably damaging Het
Ncoa1 A G 12: 4,278,181 F775L probably benign Het
Ndufa11 C A 17: 56,721,331 A70E probably damaging Het
Nfx1 A G 4: 40,976,851 Y175C possibly damaging Het
Olfr1121 A G 2: 87,371,565 N11S probably damaging Het
Olfr1419 A T 19: 11,870,727 L163Q probably damaging Het
Pcsk6 T C 7: 65,969,014 S443P probably damaging Het
Pcsk9 T C 4: 106,447,596 D425G probably benign Het
Pdcd1lg2 T A 19: 29,437,298 C42S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Rbm46 G A 3: 82,863,955 T451M probably benign Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Rpl7l1 T C 17: 46,782,622 E4G probably benign Het
Rptn A G 3: 93,397,199 E613G probably benign Het
Sbk2 T C 7: 4,957,622 D183G probably damaging Het
Slc15a4 C T 5: 127,616,886 A162T probably benign Het
Slc30a4 A G 2: 122,686,046 W315R probably damaging Het
Slc39a14 G C 14: 70,309,813 F361L probably benign Het
Slc6a13 T C 6: 121,336,842 Y515H possibly damaging Het
Slitrk3 C A 3: 73,049,914 K508N possibly damaging Het
Stard4 T C 18: 33,205,225 D144G probably benign Het
Tlr9 T C 9: 106,224,937 F476L probably damaging Het
Tshz1 A T 18: 84,013,220 V1021D probably damaging Het
Vmn1r54 A T 6: 90,269,322 I73F probably benign Het
Vmn2r19 A C 6: 123,316,153 S385R possibly damaging Het
Xkr5 A G 8: 18,948,700 L34P probably damaging Het
Xpo4 A G 14: 57,638,313 V121A probably damaging Het
Zbtb40 T A 4: 136,984,866 H268L probably null Het
Zfp865 T C 7: 5,030,066 F350S probably damaging Het
Zscan4b T C 7: 10,900,901 I472V possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7484:Adamts12 UTSW 15 11345648 missense probably benign 0.25
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11317212 missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11263337 missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11310818 missense probably benign
R8032:Adamts12 UTSW 15 11259103 critical splice donor site probably null
R8109:Adamts12 UTSW 15 11331791 missense probably benign 0.02
R8402:Adamts12 UTSW 15 11263290 missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11215727 missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11237592 missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11299929 missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11285979 missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11317357 critical splice donor site probably null
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11336383 missense not run
Z1177:Adamts12 UTSW 15 11317324 missense probably damaging 1.00
Z1177:Adamts12 UTSW 15 11336383 missense not run
Predicted Primers PCR Primer
(F):5'- AAGTGGCTTCCTGTGCTTTTAATC -3'
(R):5'- TTGCTCACTTGCCTGTAGAGG -3'

Sequencing Primer
(F):5'- GCTTCCTGTGCTTTTAATCGCTTTAG -3'
(R):5'- CTCACTTGCCTGTAGAGGTAGGAAG -3'
Posted On2018-05-04