Mutagenetix > Incidental Mutations

Incidental Mutation 'R6394:Als2'

515911

Institutional Source

Beutler Lab

Gene Symbol

Als2

Ensembl Gene

ENSMUSG00000026024

Gene Name

alsin Rho guanine nucleotide exchange factor

Synonyms

3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.793) question?

Stock #

R6394 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59162926-59237231 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59167197 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 1635 (F1635I)

Ref Sequence

ENSEMBL: ENSMUSP00000125753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000114275] [ENSMUST00000163058]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027178
AA Change: F1635I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: F1635I

Domain	Start	End	E-Value	Type
Pfam:RCC1_2	93	122	1.1e-9	PFAM
Pfam:RCC1	109	165	9.5e-11	PFAM
Pfam:RCC1	170	216	6.6e-11	PFAM
low complexity region	268	282	N/A	INTRINSIC
low complexity region	465	483	N/A	INTRINSIC
Pfam:RCC1	521	568	5.4e-13	PFAM
Pfam:RCC1_2	555	584	8.3e-12	PFAM
Pfam:RCC1	571	619	3.4e-11	PFAM
Pfam:RhoGEF	688	877	6.5e-10	PFAM
PH	895	1001	2.17e0	SMART
MORN	1041	1062	1.34e-5	SMART
MORN	1064	1085	1.95e-1	SMART
MORN	1092	1113	6.68e-6	SMART
MORN	1115	1136	9.39e0	SMART
MORN	1143	1164	1.49e1	SMART
MORN	1167	1188	1.13e1	SMART
MORN	1190	1211	2.28e0	SMART
MORN	1213	1235	5.95e1	SMART
low complexity region	1470	1483	N/A	INTRINSIC
Pfam:VPS9	1546	1650	8.6e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114275

SMART Domains

Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550

Domain	Start	End	E-Value	Type
L27	46	101	4.02e-9	SMART
L27	105	158	2.49e-14	SMART
PDZ	180	253	3.57e-11	SMART
SH3	263	329	2.94e-5	SMART
low complexity region	367	381	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
GuKc	444	637	1.21e-50	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163058
AA Change: F1635I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: F1635I

Domain	Start	End	E-Value	Type
Pfam:RCC1_2	93	122	9.9e-10	PFAM
Pfam:RCC1	109	165	9.5e-12	PFAM
Pfam:RCC1	170	216	4.9e-12	PFAM
low complexity region	268	282	N/A	INTRINSIC
low complexity region	465	483	N/A	INTRINSIC
Pfam:RCC1	521	568	4.6e-14	PFAM
Pfam:RCC1_2	555	584	1.2e-11	PFAM
Pfam:RCC1	571	619	8.6e-11	PFAM
Pfam:RhoGEF	688	877	2.6e-10	PFAM
PH	895	1001	2.17e0	SMART
MORN	1041	1062	1.34e-5	SMART
MORN	1064	1085	1.95e-1	SMART
MORN	1092	1113	6.68e-6	SMART
MORN	1115	1136	9.39e0	SMART
MORN	1143	1164	1.49e1	SMART
MORN	1167	1188	1.13e1	SMART
MORN	1190	1211	2.28e0	SMART
MORN	1213	1235	5.95e1	SMART
low complexity region	1470	1483	N/A	INTRINSIC
Pfam:VPS9	1546	1650	1e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190598

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,921,792	L174*	probably null	Het
Akap11	A	T	14: 78,522,589		probably null	Het
Alpi	T	A	1: 87,100,706	Y154F	possibly damaging	Het
Anxa1	C	T	19: 20,383,849	V60M	probably damaging	Het
Atp10b	A	G	11: 43,225,637	Y937C	probably damaging	Het
Brd4	C	A	17: 32,224,147	E167*	probably null	Het
Cacna1h	G	A	17: 25,387,481	T1048I	probably benign	Het
Ccdc113	A	G	8: 95,557,192	D298G	probably benign	Het
Cfap100	T	A	6: 90,417,623	N74I	possibly damaging	Het
Chd8	A	T	14: 52,202,585	H4Q	possibly damaging	Het
Clcn1	A	G	6: 42,307,590	T621A	possibly damaging	Het
Clcn1	A	G	6: 42,313,238	T843A	possibly damaging	Het
Clcn3	C	T	8: 60,941,291	R68Q	probably damaging	Het
Dcaf13	T	A	15: 39,143,737	N355K	probably benign	Het
Dnah6	A	T	6: 73,155,418	C1100*	probably null	Het
Dync2h1	A	T	9: 7,168,331	V428E	probably damaging	Het
E230025N22Rik	T	C	18: 36,686,786	E317G	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Evc2	C	A	5: 37,378,275	D431E	probably damaging	Het
Gcm2	T	G	13: 41,109,897	T20P	probably damaging	Het
Gdf9	A	G	11: 53,436,697	Y160C	probably damaging	Het
Gm8220	A	G	14: 44,285,677		probably benign	Het
Gm9573	A	T	17: 35,620,166		probably benign	Het
Gpalpp1	A	T	14: 76,107,412	S44T	possibly damaging	Het
Grip2	T	C	6: 91,787,201	Y134C	probably damaging	Het
Hephl1	A	G	9: 15,074,101	F753S	probably benign	Het
Herc1	A	G	9: 66,395,059	T727A	probably damaging	Het
Herc2	A	G	7: 56,215,981	E4232G	probably damaging	Het
Ifi207	A	G	1: 173,729,015	L726P	probably benign	Het
Itga11	T	A	9: 62,735,266		probably null	Het
Jrkl	A	C	9: 13,245,490	Y55*	probably null	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Kif18b	A	G	11: 102,914,410	V303A	probably damaging	Het
Klhl29	A	T	12: 5,094,830	C423*	probably null	Het
Klhl29	T	C	12: 5,137,720	S215G	probably benign	Het
Lamp5	A	G	2: 136,061,009	D216G	possibly damaging	Het
Leo1	T	A	9: 75,445,470	D98E	probably benign	Het
Map3k3	T	C	11: 106,148,883	V283A	probably benign	Het
Med12l	A	G	3: 59,235,087	K902E	probably damaging	Het
Mmp1b	C	A	9: 7,386,316	D202Y	probably benign	Het
Olfr1201	C	T	2: 88,794,952	T190I	probably benign	Het
Olfr239	G	A	17: 33,199,513	G155D	probably damaging	Het
Olfr488	C	T	7: 108,255,763	R125H	possibly damaging	Het
Olfr657	T	A	7: 104,635,702	N9K	possibly damaging	Het
Olfr657	T	C	7: 104,636,027	S118P	possibly damaging	Het
Olfr816	G	T	10: 129,911,920	D119E	probably damaging	Het
Olfr979	T	C	9: 40,000,705	Q174R	probably benign	Het
Onecut3	A	G	10: 80,496,013	I336V	probably damaging	Het
Oprl1	C	T	2: 181,719,002	R257C	probably damaging	Het
Osbpl6	T	C	2: 76,555,954	V207A	probably benign	Het
Pde3a	A	T	6: 141,487,511	H756L	probably damaging	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phyh	A	G	2: 4,936,003	D238G	probably benign	Het
Pnliprp2	T	A	19: 58,761,598	N92K	probably benign	Het
Pole3	T	C	4: 62,524,026		probably benign	Het
Ppm1d	T	C	11: 85,339,672	V372A	probably benign	Het
Prpf40a	A	T	2: 53,144,878	I766N	probably damaging	Het
Prr5	T	A	15: 84,699,724	V175E	probably damaging	Het
Ptprq	T	A	10: 107,642,943	K1280*	probably null	Het
Rbp2	T	A	9: 98,507,820	V95E	possibly damaging	Het
Rictor	T	C	15: 6,769,309	F346L	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Scn10a	T	A	9: 119,661,320	I519F	probably benign	Het
Setd5	T	G	6: 113,115,544	V295G	probably damaging	Het
Shcbp1	A	T	8: 4,736,176	M642K	probably damaging	Het
Slc13a3	C	T	2: 165,434,097	G243E	probably damaging	Het
Smg9	T	C	7: 24,422,307	Y498H	probably damaging	Het
Sox5	T	C	6: 144,041,313	D175G	probably damaging	Het
Stard7	A	G	2: 127,284,241	D71G	probably damaging	Het
Stxbp5	A	T	10: 9,899,231	Y59*	probably null	Het
Supt6	G	A	11: 78,231,065	R254C	probably damaging	Het
Syne2	C	T	12: 75,990,495	T3817I	probably benign	Het
Tas2r124	T	A	6: 132,755,076	I116N	probably damaging	Het
Trim9	T	A	12: 70,255,213	E550D	possibly damaging	Het
Vmn2r50	A	G	7: 10,040,326	S548P	probably damaging	Het
Zmynd8	C	A	2: 165,846,023	E126*	probably null	Het
Zswim9	A	T	7: 13,260,963	S422R	probably damaging	Het

Other mutations in Als2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Als2	APN	1	59169896	nonsense	probably null
IGL00924:Als2	APN	1	59215862	missense	probably benign	0.03
IGL00949:Als2	APN	1	59215572	missense	probably damaging	1.00
IGL00950:Als2	APN	1	59215382	missense	probably benign	0.01
IGL01090:Als2	APN	1	59215616	missense	possibly damaging	0.81
IGL01116:Als2	APN	1	59186004	splice site	probably benign
IGL02001:Als2	APN	1	59180188	splice site	probably benign
IGL02075:Als2	APN	1	59207786	missense	probably damaging	1.00
IGL02441:Als2	APN	1	59215472	missense	probably damaging	0.98
IGL02728:Als2	APN	1	59196347	missense	probably benign	0.00
IGL02740:Als2	APN	1	59169919	missense	probably benign	0.01
IGL02885:Als2	APN	1	59167491	missense	probably benign	0.30
IGL02896:Als2	APN	1	59183787	missense	probably benign	0.17
IGL02978:Als2	APN	1	59215165	missense	probably benign	0.32
IGL03032:Als2	APN	1	59216030	splice site	probably benign
IGL03065:Als2	APN	1	59215872	missense	probably benign
IGL03212:Als2	APN	1	59202926	missense	probably benign	0.00
IGL03226:Als2	APN	1	59186520	missense	probably benign	0.43
R0014:Als2	UTSW	1	59211388	missense	possibly damaging	0.53
R0243:Als2	UTSW	1	59215387	missense	probably benign
R0326:Als2	UTSW	1	59180583	missense	probably damaging	1.00
R0376:Als2	UTSW	1	59215565	missense	probably benign	0.00
R0605:Als2	UTSW	1	59168414	missense	probably benign	0.02
R1607:Als2	UTSW	1	59180147	missense	probably damaging	1.00
R1631:Als2	UTSW	1	59218067	missense	probably benign	0.00
R1657:Als2	UTSW	1	59180601	missense	probably damaging	1.00
R1763:Als2	UTSW	1	59174991	missense	probably benign
R1950:Als2	UTSW	1	59185601	critical splice acceptor site	probably null
R1970:Als2	UTSW	1	59215169	missense	probably benign	0.34
R2151:Als2	UTSW	1	59207789	missense	probably damaging	1.00
R2292:Als2	UTSW	1	59187385	missense	probably damaging	1.00
R2513:Als2	UTSW	1	59215117	missense	probably benign	0.00
R2849:Als2	UTSW	1	59206538	missense	probably damaging	0.97
R2869:Als2	UTSW	1	59211137	missense	probably damaging	1.00
R2869:Als2	UTSW	1	59211137	missense	probably damaging	1.00
R2870:Als2	UTSW	1	59211137	missense	probably damaging	1.00
R2870:Als2	UTSW	1	59211137	missense	probably damaging	1.00
R2872:Als2	UTSW	1	59211137	missense	probably damaging	1.00
R2872:Als2	UTSW	1	59211137	missense	probably damaging	1.00
R2873:Als2	UTSW	1	59211137	missense	probably damaging	1.00
R3054:Als2	UTSW	1	59215494	missense	probably damaging	1.00
R3081:Als2	UTSW	1	59187349	missense	probably damaging	1.00
R3176:Als2	UTSW	1	59170008	missense	possibly damaging	0.88
R3276:Als2	UTSW	1	59170008	missense	possibly damaging	0.88
R3801:Als2	UTSW	1	59167199	missense	probably damaging	1.00
R3803:Als2	UTSW	1	59167199	missense	probably damaging	1.00
R3808:Als2	UTSW	1	59170450	missense	probably benign	0.08
R3884:Als2	UTSW	1	59185568	missense	probably damaging	0.99
R4012:Als2	UTSW	1	59187416	missense	probably benign	0.09
R4033:Als2	UTSW	1	59196241	missense	probably benign
R4201:Als2	UTSW	1	59180154	missense	possibly damaging	0.77
R4321:Als2	UTSW	1	59167454	splice site	probably benign
R4707:Als2	UTSW	1	59215313	missense	probably benign
R4784:Als2	UTSW	1	59215313	missense	probably benign
R4785:Als2	UTSW	1	59215313	missense	probably benign
R4991:Als2	UTSW	1	59207768	missense	probably benign	0.10
R5068:Als2	UTSW	1	59211274	missense	probably benign	0.13
R5110:Als2	UTSW	1	59185441	missense	probably damaging	0.98
R5141:Als2	UTSW	1	59170452	missense	possibly damaging	0.80
R5394:Als2	UTSW	1	59174946	missense	probably benign	0.06
R5621:Als2	UTSW	1	59191890	missense	probably benign	0.33
R5685:Als2	UTSW	1	59179091	missense	possibly damaging	0.73
R5987:Als2	UTSW	1	59206587	missense	probably damaging	1.00
R6012:Als2	UTSW	1	59185215	missense	probably damaging	1.00
R6118:Als2	UTSW	1	59203069	missense	possibly damaging	0.62
R6222:Als2	UTSW	1	59180125	missense	probably benign	0.04
R6367:Als2	UTSW	1	59199140	missense	probably benign	0.04
R6866:Als2	UTSW	1	59211133	missense	probably damaging	1.00
R6965:Als2	UTSW	1	59170557	missense	possibly damaging	0.70
R7038:Als2	UTSW	1	59167514	missense	possibly damaging	0.94
R7178:Als2	UTSW	1	59207812	missense	probably damaging	0.96
R7494:Als2	UTSW	1	59183166	splice site	probably null
R7541:Als2	UTSW	1	59167616	splice site	probably null
R7601:Als2	UTSW	1	59170002	missense	probably benign	0.17
R8380:Als2	UTSW	1	59211308	missense	probably benign
R8478:Als2	UTSW	1	59186016	missense	probably damaging	0.96
R8492:Als2	UTSW	1	59211344	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGGCCAGCTTGGAAATAAACC -3'
(R):5'- TGCTGCTCCTGTCAGAATAG -3'

Sequencing Primer
(F):5'- GCTTGGAAATAAACCATCCCTC -3'
(R):5'- GCTGCTCCTGTCAGAATAGAATGTC -3'

Posted On

2018-05-04