Incidental Mutation 'R6394:Setd5'
ID515933
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 113115544 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 295 (V295G)
Ref Sequence ENSEMBL: ENSMUSP00000108782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect probably damaging
Transcript: ENSMUST00000042889
AA Change: V276G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: V276G

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: V295G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: V295G

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: V295G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: V295G

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204377
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113110889 missense probably damaging 1.00
R7621:Setd5 UTSW 6 113144049 missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113121764 missense probably damaging 1.00
R7986:Setd5 UTSW 6 113128457 missense probably benign 0.00
R8083:Setd5 UTSW 6 113115010 missense probably damaging 1.00
R8175:Setd5 UTSW 6 113114913 missense probably damaging 1.00
R8252:Setd5 UTSW 6 113150955 missense probably benign 0.01
R8268:Setd5 UTSW 6 113149690 critical splice donor site probably null
R8271:Setd5 UTSW 6 113115070 missense possibly damaging 0.58
R8424:Setd5 UTSW 6 113149683 missense probably benign 0.12
R8508:Setd5 UTSW 6 113121087 missense probably damaging 1.00
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Z1176:Setd5 UTSW 6 113138096 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACCTTCTCTGGGACCACTAATTG -3'
(R):5'- TCAGTCAGAACCATGCAAGC -3'

Sequencing Primer
(F):5'- GTTTCCTGGAAACTTGAGATTATGTC -3'
(R):5'- TGCAAGCCCTCAATGCTC -3'
Posted On2018-05-04