Incidental Mutation 'R6394:Pde3a'
ID515935
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Namephosphodiesterase 3A, cGMP inhibited
SynonymsA930022O17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R6394 (G1)
Quality Score168.009
Status Not validated
Chromosome6
Chromosomal Location141249269-141507448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141487511 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 756 (H756L)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
Predicted Effect probably damaging
Transcript: ENSMUST00000043259
AA Change: H756L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: H756L

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141459738 missense probably damaging 1.00
IGL01400:Pde3a APN 6 141459228 missense probably benign 0.02
IGL01752:Pde3a APN 6 141487613 splice site probably benign
IGL01819:Pde3a APN 6 141487537 missense probably damaging 1.00
IGL02014:Pde3a APN 6 141459144 missense probably null 1.00
IGL02119:Pde3a APN 6 141459803 missense probably damaging 0.97
IGL02465:Pde3a APN 6 141249675 missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141405172 splice site probably benign
IGL02961:Pde3a APN 6 141459700 nonsense probably null
IGL03034:Pde3a APN 6 141492400 splice site probably benign
IGL03142:Pde3a APN 6 141492299 missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141492310 missense probably benign 0.04
R0412:Pde3a UTSW 6 141498684 missense probably damaging 1.00
R0517:Pde3a UTSW 6 141498657 nonsense probably null
R0573:Pde3a UTSW 6 141492231 missense probably damaging 1.00
R0621:Pde3a UTSW 6 141249999 missense probably damaging 1.00
R0781:Pde3a UTSW 6 141459316 splice site probably benign
R1065:Pde3a UTSW 6 141476732 splice site probably benign
R1110:Pde3a UTSW 6 141459316 splice site probably benign
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1480:Pde3a UTSW 6 141487574 missense probably benign 0.17
R1559:Pde3a UTSW 6 141459098 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141250353 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141487513 missense probably damaging 1.00
R1902:Pde3a UTSW 6 141498770 missense probably benign
R1909:Pde3a UTSW 6 141250239 missense probably benign 0.00
R2048:Pde3a UTSW 6 141489006 splice site probably benign
R2144:Pde3a UTSW 6 141490111 missense probably benign 0.40
R2155:Pde3a UTSW 6 141483914 missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141250347 missense probably damaging 0.97
R2405:Pde3a UTSW 6 141481242 missense probably damaging 1.00
R4592:Pde3a UTSW 6 141459216 missense probably benign 0.13
R4677:Pde3a UTSW 6 141466139 missense probably benign 0.02
R4803:Pde3a UTSW 6 141459086 missense probably damaging 1.00
R4887:Pde3a UTSW 6 141470942 missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141250025 missense probably benign 0.00
R5055:Pde3a UTSW 6 141487956 nonsense probably null
R5181:Pde3a UTSW 6 141481255 critical splice donor site probably null
R5640:Pde3a UTSW 6 141483915 missense probably damaging 0.99
R5694:Pde3a UTSW 6 141250502 missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141498889 missense possibly damaging 0.96
R6692:Pde3a UTSW 6 141479346 missense probably damaging 1.00
R6968:Pde3a UTSW 6 141487932 missense probably damaging 1.00
R7137:Pde3a UTSW 6 141498746 missense probably benign 0.26
R7163:Pde3a UTSW 6 141487544 missense probably damaging 1.00
R7677:Pde3a UTSW 6 141250257 missense probably damaging 1.00
R7754:Pde3a UTSW 6 141459249 missense probably benign 0.32
X0053:Pde3a UTSW 6 141483969 splice site probably null
X0062:Pde3a UTSW 6 141249984 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTCACTGTAGAAATGATGTGG -3'
(R):5'- CTGTGAAGCTGGGATTACCTG -3'

Sequencing Primer
(F):5'- GGAATTTCCAAAAGTCCCTGTCCTAG -3'
(R):5'- AAGCTGGGATTACCTGACTTG -3'
Posted On2018-05-04