Incidental Mutation 'R6394:Rbp2'
ID515957
Institutional Source Beutler Lab
Gene Symbol Rbp2
Ensembl Gene ENSMUSG00000032454
Gene Nameretinol binding protein 2, cellular
SynonymsRbp-2, CrbpII, Crbp-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location98486115-98509781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98507820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 95 (V95E)
Ref Sequence ENSEMBL: ENSMUSP00000140676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035029] [ENSMUST00000187905] [ENSMUST00000189446]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035029
AA Change: V95E

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035029
Gene: ENSMUSG00000032454
AA Change: V95E

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000187905
AA Change: V95E

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140630
Gene: ENSMUSG00000032454
AA Change: V95E

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189446
AA Change: V95E

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140676
Gene: ENSMUSG00000032454
AA Change: V95E

DomainStartEndE-ValueType
Pfam:Lipocalin_7 4 134 4.2e-11 PFAM
Pfam:Lipocalin 6 134 4.3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an abundant protein present in the small intestinal epithelium. It is thought to participate in the uptake and/or intracellular metabolism of vitamin A. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. This protein may also modulate the supply of retinoic acid to the nuclei of endometrial cells during the menstrual cycle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Saturable vitamin A (retinol) uptake is impaired in homozygous mutant mice. Serum retinol levels are unaffected when with normal dietary intake, however, pups of homozygous dams fed a marginal retinol diet show increased neonatal lethality due to inadequate retinal transport to the fetus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Rbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Rbp2 APN 9 98498897 splice site probably null
R3780:Rbp2 UTSW 9 98498826 missense probably benign
R4835:Rbp2 UTSW 9 98507823 missense probably damaging 0.99
R4980:Rbp2 UTSW 9 98498841 missense probably benign 0.01
R6253:Rbp2 UTSW 9 98490647 missense probably benign 0.02
R6254:Rbp2 UTSW 9 98490647 missense probably benign 0.02
R6312:Rbp2 UTSW 9 98490647 missense probably benign 0.02
R6819:Rbp2 UTSW 9 98509561 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTCCCTGAGATCATGGAG -3'
(R):5'- TCGCAGCTATTCACAGAAACAG -3'

Sequencing Primer
(F):5'- CAAGGTCATCCGTGTGAT -3'
(R):5'- CAGCCGTATAGATTTCTTCCTAGAG -3'
Posted On2018-05-04