Mutagenetix > Incidental Mutations

Incidental Mutation 'R6394:Stxbp5'

515959

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6394 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 9899231 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 59 (Y59*)

Ref Sequence

ENSEMBL: ENSMUSP00000123253 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

Predicted Effect

probably null
Transcript: ENSMUST00000038213
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: Y59*

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000125200
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: Y59*

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000141722
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: Y59*

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218800

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,921,792	L174*	probably null	Het
Akap11	A	T	14: 78,522,589		probably null	Het
Alpi	T	A	1: 87,100,706	Y154F	possibly damaging	Het
Als2	A	T	1: 59,167,197	F1635I	probably damaging	Het
Anxa1	C	T	19: 20,383,849	V60M	probably damaging	Het
Atp10b	A	G	11: 43,225,637	Y937C	probably damaging	Het
Brd4	C	A	17: 32,224,147	E167*	probably null	Het
Cacna1h	G	A	17: 25,387,481	T1048I	probably benign	Het
Ccdc113	A	G	8: 95,557,192	D298G	probably benign	Het
Cfap100	T	A	6: 90,417,623	N74I	possibly damaging	Het
Chd8	A	T	14: 52,202,585	H4Q	possibly damaging	Het
Clcn1	A	G	6: 42,307,590	T621A	possibly damaging	Het
Clcn1	A	G	6: 42,313,238	T843A	possibly damaging	Het
Clcn3	C	T	8: 60,941,291	R68Q	probably damaging	Het
Dcaf13	T	A	15: 39,143,737	N355K	probably benign	Het
Dnah6	A	T	6: 73,155,418	C1100*	probably null	Het
Dync2h1	A	T	9: 7,168,331	V428E	probably damaging	Het
E230025N22Rik	T	C	18: 36,686,786	E317G	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Evc2	C	A	5: 37,378,275	D431E	probably damaging	Het
Gcm2	T	G	13: 41,109,897	T20P	probably damaging	Het
Gdf9	A	G	11: 53,436,697	Y160C	probably damaging	Het
Gm8220	A	G	14: 44,285,677		probably benign	Het
Gm9573	A	T	17: 35,620,166		probably benign	Het
Gpalpp1	A	T	14: 76,107,412	S44T	possibly damaging	Het
Grip2	T	C	6: 91,787,201	Y134C	probably damaging	Het
Hephl1	A	G	9: 15,074,101	F753S	probably benign	Het
Herc1	A	G	9: 66,395,059	T727A	probably damaging	Het
Herc2	A	G	7: 56,215,981	E4232G	probably damaging	Het
Ifi207	A	G	1: 173,729,015	L726P	probably benign	Het
Itga11	T	A	9: 62,735,266		probably null	Het
Jrkl	A	C	9: 13,245,490	Y55*	probably null	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Kif18b	A	G	11: 102,914,410	V303A	probably damaging	Het
Klhl29	A	T	12: 5,094,830	C423*	probably null	Het
Klhl29	T	C	12: 5,137,720	S215G	probably benign	Het
Lamp5	A	G	2: 136,061,009	D216G	possibly damaging	Het
Leo1	T	A	9: 75,445,470	D98E	probably benign	Het
Map3k3	T	C	11: 106,148,883	V283A	probably benign	Het
Med12l	A	G	3: 59,235,087	K902E	probably damaging	Het
Mmp1b	C	A	9: 7,386,316	D202Y	probably benign	Het
Olfr1201	C	T	2: 88,794,952	T190I	probably benign	Het
Olfr239	G	A	17: 33,199,513	G155D	probably damaging	Het
Olfr488	C	T	7: 108,255,763	R125H	possibly damaging	Het
Olfr657	T	A	7: 104,635,702	N9K	possibly damaging	Het
Olfr657	T	C	7: 104,636,027	S118P	possibly damaging	Het
Olfr816	G	T	10: 129,911,920	D119E	probably damaging	Het
Olfr979	T	C	9: 40,000,705	Q174R	probably benign	Het
Onecut3	A	G	10: 80,496,013	I336V	probably damaging	Het
Oprl1	C	T	2: 181,719,002	R257C	probably damaging	Het
Osbpl6	T	C	2: 76,555,954	V207A	probably benign	Het
Pde3a	A	T	6: 141,487,511	H756L	probably damaging	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phyh	A	G	2: 4,936,003	D238G	probably benign	Het
Pnliprp2	T	A	19: 58,761,598	N92K	probably benign	Het
Pole3	T	C	4: 62,524,026		probably benign	Het
Ppm1d	T	C	11: 85,339,672	V372A	probably benign	Het
Prpf40a	A	T	2: 53,144,878	I766N	probably damaging	Het
Prr5	T	A	15: 84,699,724	V175E	probably damaging	Het
Ptprq	T	A	10: 107,642,943	K1280*	probably null	Het
Rbp2	T	A	9: 98,507,820	V95E	possibly damaging	Het
Rictor	T	C	15: 6,769,309	F346L	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Scn10a	T	A	9: 119,661,320	I519F	probably benign	Het
Setd5	T	G	6: 113,115,544	V295G	probably damaging	Het
Shcbp1	A	T	8: 4,736,176	M642K	probably damaging	Het
Slc13a3	C	T	2: 165,434,097	G243E	probably damaging	Het
Smg9	T	C	7: 24,422,307	Y498H	probably damaging	Het
Sox5	T	C	6: 144,041,313	D175G	probably damaging	Het
Stard7	A	G	2: 127,284,241	D71G	probably damaging	Het
Supt6	G	A	11: 78,231,065	R254C	probably damaging	Het
Syne2	C	T	12: 75,990,495	T3817I	probably benign	Het
Tas2r124	T	A	6: 132,755,076	I116N	probably damaging	Het
Trim9	T	A	12: 70,255,213	E550D	possibly damaging	Het
Vmn2r50	A	G	7: 10,040,326	S548P	probably damaging	Het
Zmynd8	C	A	2: 165,846,023	E126*	probably null	Het
Zswim9	A	T	7: 13,260,963	S422R	probably damaging	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGTAGGAACGACTGAGAGCC -3'
(R):5'- TGCCCTCTGTGAAGTTACTAGC -3'

Sequencing Primer
(F):5'- GCCTGCACCACATAATTTCTTATAG -3'
(R):5'- GCTTGTTCCTTAAGATAGAGTCCAC -3'

Posted On

2018-05-04