Incidental Mutation 'R6394:Atp10b'
ID515963
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene NameATPase, class V, type 10B
Synonyms5930426O13Rik, 9030605H24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location43149877-43262285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43225637 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 937 (Y937C)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
Predicted Effect probably damaging
Transcript: ENSMUST00000077659
AA Change: Y937C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: Y937C

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136288
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43202161 missense probably damaging 1.00
IGL01385:Atp10b APN 11 43234429 missense probably damaging 1.00
IGL01524:Atp10b APN 11 43259845 missense probably benign 0.18
IGL01575:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01588:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01590:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01832:Atp10b APN 11 43234435 missense probably damaging 0.98
IGL01927:Atp10b APN 11 43259404 splice site probably benign
IGL01933:Atp10b APN 11 43194630 missense probably damaging 1.00
IGL02182:Atp10b APN 11 43248947 missense probably damaging 1.00
IGL02215:Atp10b APN 11 43194665 critical splice donor site probably null
IGL02216:Atp10b APN 11 43259789 missense probably damaging 0.98
IGL02973:Atp10b APN 11 43197509 missense probably damaging 1.00
IGL03012:Atp10b APN 11 43194655 missense probably damaging 0.99
IGL03106:Atp10b APN 11 43247477 missense probably benign 0.32
IGL03123:Atp10b APN 11 43153283 missense probably benign 0.01
IGL03202:Atp10b APN 11 43234441 critical splice donor site probably null
IGL03339:Atp10b APN 11 43230615 missense probably null 0.71
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0281:Atp10b UTSW 11 43153304 missense probably benign 0.00
R0379:Atp10b UTSW 11 43254314 missense probably benign 0.05
R0380:Atp10b UTSW 11 43225597 missense probably damaging 1.00
R0470:Atp10b UTSW 11 43203039 missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43151655 nonsense probably null
R1368:Atp10b UTSW 11 43202154 missense probably damaging 1.00
R1370:Atp10b UTSW 11 43151655 nonsense probably null
R1413:Atp10b UTSW 11 43230564 missense probably benign 0.00
R1502:Atp10b UTSW 11 43230347 missense probably damaging 1.00
R1530:Atp10b UTSW 11 43197524 missense probably benign 0.03
R1596:Atp10b UTSW 11 43235767 missense probably damaging 1.00
R1675:Atp10b UTSW 11 43225648 missense probably damaging 1.00
R1880:Atp10b UTSW 11 43259432 missense probably damaging 1.00
R1938:Atp10b UTSW 11 43230418 missense probably benign 0.00
R1986:Atp10b UTSW 11 43172768 missense probably benign 0.12
R2081:Atp10b UTSW 11 43202128 missense probably damaging 1.00
R2083:Atp10b UTSW 11 43212423 missense probably benign 0.24
R2159:Atp10b UTSW 11 43151853 missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43234380 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43172745 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43189613 missense probably damaging 1.00
R3741:Atp10b UTSW 11 43235662 missense probably damaging 1.00
R3942:Atp10b UTSW 11 43172754 missense probably damaging 1.00
R3971:Atp10b UTSW 11 43216512 missense probably damaging 1.00
R4007:Atp10b UTSW 11 43259852 missense probably benign 0.04
R4050:Atp10b UTSW 11 43259536 missense probably benign 0.00
R4078:Atp10b UTSW 11 43153283 missense probably benign 0.01
R4567:Atp10b UTSW 11 43197557 missense probably benign 0.03
R4651:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4652:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4667:Atp10b UTSW 11 43247518 missense probably damaging 1.00
R4720:Atp10b UTSW 11 43203122 missense probably benign
R4987:Atp10b UTSW 11 43151613 utr 5 prime probably benign
R5232:Atp10b UTSW 11 43202179 missense probably damaging 1.00
R5233:Atp10b UTSW 11 43230560 missense probably benign 0.06
R5281:Atp10b UTSW 11 43254336 missense probably damaging 0.97
R5307:Atp10b UTSW 11 43212475 missense probably damaging 1.00
R5460:Atp10b UTSW 11 43230455 missense probably benign 0.00
R5518:Atp10b UTSW 11 43151636 missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43245425 missense probably damaging 1.00
R5688:Atp10b UTSW 11 43201173 missense probably benign 0.00
R5735:Atp10b UTSW 11 43151774 missense probably benign 0.00
R6153:Atp10b UTSW 11 43254282 missense probably damaging 1.00
R6251:Atp10b UTSW 11 43235746 missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43201238 missense probably benign 0.24
R6492:Atp10b UTSW 11 43218957 missense probably damaging 1.00
R6769:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6771:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6775:Atp10b UTSW 11 43222213 missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43245464 missense probably damaging 1.00
R7322:Atp10b UTSW 11 43212547 missense probably damaging 1.00
R7367:Atp10b UTSW 11 43247501 missense probably damaging 1.00
R7538:Atp10b UTSW 11 43225546 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGCTGCCACACATTTGACC -3'
(R):5'- ACTCCCTGGTAAGTAGCAATCAAAG -3'

Sequencing Primer
(F):5'- GCTGCCACACATTTGACCTAACTG -3'
(R):5'- CCTGGTAAGTAGCAATCAAAGTGACC -3'
Posted On2018-05-04