Incidental Mutation 'R6394:Supt6'
ID515965
Institutional Source Beutler Lab
Gene Symbol Supt6
Ensembl Gene ENSMUSG00000002052
Gene Namesuppressor of Ty 6
SynonymsSPT6, Supt6h, 5131400N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location78206746-78245987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78231065 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 254 (R254C)
Ref Sequence ENSEMBL: ENSMUSP00000002121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002121]
Predicted Effect probably damaging
Transcript: ENSMUST00000002121
AA Change: R254C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002121
Gene: ENSMUSG00000002052
AA Change: R254C

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:SPT6_acidic 37 127 8.8e-19 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 220 250 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
Pfam:HTH_44 305 432 1.3e-28 PFAM
low complexity region 494 509 N/A INTRINSIC
YqgFc 779 894 4.27e-21 SMART
Pfam:HHH_7 935 1038 3.1e-55 PFAM
Pfam:HHH_3 966 1036 5.2e-10 PFAM
Pfam:DLD 1051 1159 6.8e-39 PFAM
S1 1221 1282 2.8e-3 SMART
SH2 1332 1421 4.12e-11 SMART
low complexity region 1441 1454 N/A INTRINSIC
Blast:SH2 1455 1517 9e-19 BLAST
low complexity region 1586 1599 N/A INTRINSIC
low complexity region 1639 1664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during pre-implantation development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Supt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Supt6 APN 11 78231181 missense possibly damaging 0.94
IGL01457:Supt6 APN 11 78221143 missense probably damaging 1.00
IGL01608:Supt6 APN 11 78225483 missense probably damaging 1.00
IGL01739:Supt6 APN 11 78222187 missense probably damaging 1.00
IGL01765:Supt6 APN 11 78222159 missense probably benign 0.09
IGL01894:Supt6 APN 11 78222838 missense probably benign 0.00
IGL01952:Supt6 APN 11 78225760 missense probably benign 0.01
IGL02067:Supt6 APN 11 78231157 missense probably benign 0.01
IGL02244:Supt6 APN 11 78232797 missense possibly damaging 0.92
IGL02267:Supt6 APN 11 78226204 missense possibly damaging 0.72
IGL02379:Supt6 APN 11 78225369 missense possibly damaging 0.75
IGL02541:Supt6 APN 11 78226918 missense probably damaging 0.99
IGL02635:Supt6 APN 11 78212739 missense probably damaging 1.00
IGL03347:Supt6 APN 11 78232185 missense possibly damaging 0.71
IGL02980:Supt6 UTSW 11 78225722 missense probably damaging 1.00
IGL02991:Supt6 UTSW 11 78225353 missense probably damaging 1.00
R0145:Supt6 UTSW 11 78208236 missense probably benign 0.22
R0371:Supt6 UTSW 11 78223157 missense probably benign 0.00
R0452:Supt6 UTSW 11 78227003 missense probably damaging 1.00
R0464:Supt6 UTSW 11 78216338 missense probably benign 0.33
R0616:Supt6 UTSW 11 78209495 missense probably damaging 1.00
R0653:Supt6 UTSW 11 78226015 missense probably benign 0.01
R0788:Supt6 UTSW 11 78207772 unclassified probably benign
R1103:Supt6 UTSW 11 78225473 missense possibly damaging 0.59
R1282:Supt6 UTSW 11 78228768 missense possibly damaging 0.83
R1460:Supt6 UTSW 11 78222198 missense possibly damaging 0.93
R1508:Supt6 UTSW 11 78216203 critical splice donor site probably null
R1850:Supt6 UTSW 11 78219877 splice site probably benign
R1854:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R1855:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R2054:Supt6 UTSW 11 78224361 splice site probably benign
R2098:Supt6 UTSW 11 78213261 splice site probably null
R2146:Supt6 UTSW 11 78230932 missense probably damaging 1.00
R2167:Supt6 UTSW 11 78208167 missense possibly damaging 0.94
R4621:Supt6 UTSW 11 78212746 missense possibly damaging 0.65
R4734:Supt6 UTSW 11 78224683 missense probably benign 0.01
R4825:Supt6 UTSW 11 78208134 missense possibly damaging 0.84
R5575:Supt6 UTSW 11 78228961 missense probably damaging 1.00
R5789:Supt6 UTSW 11 78233586 missense unknown
R5889:Supt6 UTSW 11 78212748 missense probably damaging 0.98
R6296:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6297:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6702:Supt6 UTSW 11 78231800 missense possibly damaging 0.93
R6737:Supt6 UTSW 11 78231818 missense probably damaging 0.99
R6751:Supt6 UTSW 11 78208949 missense probably benign 0.09
R6853:Supt6 UTSW 11 78232830 missense possibly damaging 0.85
R7213:Supt6 UTSW 11 78232150 missense probably damaging 1.00
R7259:Supt6 UTSW 11 78207616 missense probably damaging 0.99
R7609:Supt6 UTSW 11 78226951 missense probably benign 0.01
R7776:Supt6 UTSW 11 78209529 missense probably damaging 0.99
X0067:Supt6 UTSW 11 78232675 missense probably benign
Z1176:Supt6 UTSW 11 78211836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTACATGGGTTTCAAAGTCC -3'
(R):5'- CTTTGCAAAGTTTCTGGGCAG -3'

Sequencing Primer
(F):5'- ACATGGGTTTCAAAGTCCATAATAG -3'
(R):5'- AGGGGCTGCATCTGTCCTC -3'
Posted On2018-05-04