Mutagenetix > Incidental Mutations

Incidental Mutation 'R6394:Gcm2'

515973

Institutional Source

Beutler Lab

Gene Symbol

Gcm2

Ensembl Gene

ENSMUSG00000021362

Gene Name

glial cells missing homolog 2

Synonyms

Gcm1-rs2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.499) question?

Stock #

R6394 (G1)

Quality Score

212.009

Status

Not validated

Chromosome

Chromosomal Location

41101427-41111035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 41109897 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 20 (T20P)

Ref Sequence

ENSEMBL: ENSMUSP00000021791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021791] [ENSMUST00000124093] [ENSMUST00000225271]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021791
AA Change: T20P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021791
Gene: ENSMUSG00000021362
AA Change: T20P

Domain	Start	End	E-Value	Type
Pfam:GCM	35	172	4.8e-74	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124093

Predicted Effect

probably benign
Transcript: ENSMUST00000225271
AA Change: T20P

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225420

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lack parathyroid glands and exhibit hypocalcemia, hypophosphatemia, a mild abnormal bone phenotype, and partial perinatal lethality. Hypoparathyroidism is observed although parathyroid hormone serum levels are normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,921,792	L174*	probably null	Het
Akap11	A	T	14: 78,522,589		probably null	Het
Alpi	T	A	1: 87,100,706	Y154F	possibly damaging	Het
Als2	A	T	1: 59,167,197	F1635I	probably damaging	Het
Anxa1	C	T	19: 20,383,849	V60M	probably damaging	Het
Atp10b	A	G	11: 43,225,637	Y937C	probably damaging	Het
Brd4	C	A	17: 32,224,147	E167*	probably null	Het
Cacna1h	G	A	17: 25,387,481	T1048I	probably benign	Het
Ccdc113	A	G	8: 95,557,192	D298G	probably benign	Het
Cfap100	T	A	6: 90,417,623	N74I	possibly damaging	Het
Chd8	A	T	14: 52,202,585	H4Q	possibly damaging	Het
Clcn1	A	G	6: 42,307,590	T621A	possibly damaging	Het
Clcn1	A	G	6: 42,313,238	T843A	possibly damaging	Het
Clcn3	C	T	8: 60,941,291	R68Q	probably damaging	Het
Dcaf13	T	A	15: 39,143,737	N355K	probably benign	Het
Dnah6	A	T	6: 73,155,418	C1100*	probably null	Het
Dync2h1	A	T	9: 7,168,331	V428E	probably damaging	Het
E230025N22Rik	T	C	18: 36,686,786	E317G	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Evc2	C	A	5: 37,378,275	D431E	probably damaging	Het
Gdf9	A	G	11: 53,436,697	Y160C	probably damaging	Het
Gm8220	A	G	14: 44,285,677		probably benign	Het
Gm9573	A	T	17: 35,620,166		probably benign	Het
Gpalpp1	A	T	14: 76,107,412	S44T	possibly damaging	Het
Grip2	T	C	6: 91,787,201	Y134C	probably damaging	Het
Hephl1	A	G	9: 15,074,101	F753S	probably benign	Het
Herc1	A	G	9: 66,395,059	T727A	probably damaging	Het
Herc2	A	G	7: 56,215,981	E4232G	probably damaging	Het
Ifi207	A	G	1: 173,729,015	L726P	probably benign	Het
Itga11	T	A	9: 62,735,266		probably null	Het
Jrkl	A	C	9: 13,245,490	Y55*	probably null	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Kif18b	A	G	11: 102,914,410	V303A	probably damaging	Het
Klhl29	A	T	12: 5,094,830	C423*	probably null	Het
Klhl29	T	C	12: 5,137,720	S215G	probably benign	Het
Lamp5	A	G	2: 136,061,009	D216G	possibly damaging	Het
Leo1	T	A	9: 75,445,470	D98E	probably benign	Het
Map3k3	T	C	11: 106,148,883	V283A	probably benign	Het
Med12l	A	G	3: 59,235,087	K902E	probably damaging	Het
Mmp1b	C	A	9: 7,386,316	D202Y	probably benign	Het
Olfr1201	C	T	2: 88,794,952	T190I	probably benign	Het
Olfr239	G	A	17: 33,199,513	G155D	probably damaging	Het
Olfr488	C	T	7: 108,255,763	R125H	possibly damaging	Het
Olfr657	T	A	7: 104,635,702	N9K	possibly damaging	Het
Olfr657	T	C	7: 104,636,027	S118P	possibly damaging	Het
Olfr816	G	T	10: 129,911,920	D119E	probably damaging	Het
Olfr979	T	C	9: 40,000,705	Q174R	probably benign	Het
Onecut3	A	G	10: 80,496,013	I336V	probably damaging	Het
Oprl1	C	T	2: 181,719,002	R257C	probably damaging	Het
Osbpl6	T	C	2: 76,555,954	V207A	probably benign	Het
Pde3a	A	T	6: 141,487,511	H756L	probably damaging	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phyh	A	G	2: 4,936,003	D238G	probably benign	Het
Pnliprp2	T	A	19: 58,761,598	N92K	probably benign	Het
Pole3	T	C	4: 62,524,026		probably benign	Het
Ppm1d	T	C	11: 85,339,672	V372A	probably benign	Het
Prpf40a	A	T	2: 53,144,878	I766N	probably damaging	Het
Prr5	T	A	15: 84,699,724	V175E	probably damaging	Het
Ptprq	T	A	10: 107,642,943	K1280*	probably null	Het
Rbp2	T	A	9: 98,507,820	V95E	possibly damaging	Het
Rictor	T	C	15: 6,769,309	F346L	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Scn10a	T	A	9: 119,661,320	I519F	probably benign	Het
Setd5	T	G	6: 113,115,544	V295G	probably damaging	Het
Shcbp1	A	T	8: 4,736,176	M642K	probably damaging	Het
Slc13a3	C	T	2: 165,434,097	G243E	probably damaging	Het
Smg9	T	C	7: 24,422,307	Y498H	probably damaging	Het
Sox5	T	C	6: 144,041,313	D175G	probably damaging	Het
Stard7	A	G	2: 127,284,241	D71G	probably damaging	Het
Stxbp5	A	T	10: 9,899,231	Y59*	probably null	Het
Supt6	G	A	11: 78,231,065	R254C	probably damaging	Het
Syne2	C	T	12: 75,990,495	T3817I	probably benign	Het
Tas2r124	T	A	6: 132,755,076	I116N	probably damaging	Het
Trim9	T	A	12: 70,255,213	E550D	possibly damaging	Het
Vmn2r50	A	G	7: 10,040,326	S548P	probably damaging	Het
Zmynd8	C	A	2: 165,846,023	E126*	probably null	Het
Zswim9	A	T	7: 13,260,963	S422R	probably damaging	Het

Other mutations in Gcm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Gcm2	APN	13	41103131	missense	probably damaging	1.00
IGL01476:Gcm2	APN	13	41105741	missense	probably damaging	1.00
IGL02034:Gcm2	APN	13	41105793	missense	probably damaging	1.00
IGL02186:Gcm2	APN	13	41104649	missense	possibly damaging	0.93
IGL02456:Gcm2	APN	13	41103001	missense	probably benign	0.01
IGL03142:Gcm2	APN	13	41103235	missense	probably benign	0.01
IGL03184:Gcm2	APN	13	41105412	missense	probably damaging	1.00
PIT4403001:Gcm2	UTSW	13	41102839	missense	probably benign	0.01
R0227:Gcm2	UTSW	13	41105856	missense	probably damaging	0.99
R1061:Gcm2	UTSW	13	41105871	missense	probably damaging	1.00
R1813:Gcm2	UTSW	13	41105891	missense	probably benign	0.19
R2057:Gcm2	UTSW	13	41109954	start codon destroyed	probably null	0.28
R2058:Gcm2	UTSW	13	41109954	start codon destroyed	probably null	0.28
R2059:Gcm2	UTSW	13	41109954	start codon destroyed	probably null	0.28
R2351:Gcm2	UTSW	13	41103618	missense	probably benign	0.02
R4653:Gcm2	UTSW	13	41102841	missense	probably benign	0.21
R4782:Gcm2	UTSW	13	41103494	missense	possibly damaging	0.66
R4799:Gcm2	UTSW	13	41103494	missense	possibly damaging	0.66
R5135:Gcm2	UTSW	13	41102959	missense	probably benign
R5162:Gcm2	UTSW	13	41103655	missense	probably benign	0.01
R5665:Gcm2	UTSW	13	41109911	missense	possibly damaging	0.73
R5756:Gcm2	UTSW	13	41109896	missense	probably damaging	1.00
R5771:Gcm2	UTSW	13	41103515	missense	probably benign	0.40
R5928:Gcm2	UTSW	13	41103398	missense	probably benign	0.00
R5977:Gcm2	UTSW	13	41103127	missense	probably damaging	0.99
R6578:Gcm2	UTSW	13	41105678	missense	probably damaging	1.00
R6798:Gcm2	UTSW	13	41105885	missense	probably damaging	1.00
R7088:Gcm2	UTSW	13	41103364	missense	probably damaging	0.98
R7413:Gcm2	UTSW	13	41105754	missense	probably damaging	1.00
R7456:Gcm2	UTSW	13	41103275	missense	probably benign	0.02
Z1088:Gcm2	UTSW	13	41102792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAACTTCCCTACATATCCGAAG -3'
(R):5'- TTTCAGCACCTCAGCCAATG -3'

Sequencing Primer
(F):5'- ACTTCCCTACATATCCGAAGATGTG -3'
(R):5'- ACTGTCTGAATCCCTCCATATCTG -3'

Posted On

2018-05-04