Incidental Mutation 'R6394:Kif13a'
ID515974
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46752455 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 671 (V671M)
Ref Sequence ENSEMBL: ENSMUSP00000153657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056978
AA Change: V1619M

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: V1619M

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223881
AA Change: V671M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46826745 missense probably damaging 1.00
R7693:Kif13a UTSW 13 46750613 missense probably benign 0.01
R7761:Kif13a UTSW 13 46798479 missense probably benign
R8098:Kif13a UTSW 13 46815304 missense probably damaging 1.00
R8171:Kif13a UTSW 13 46778968 missense probably damaging 1.00
R8271:Kif13a UTSW 13 46752581 missense probably benign 0.01
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AACACCCATGAACTCTGTGAAGG -3'
(R):5'- TCTGTCTGACATGGCAGTCC -3'

Sequencing Primer
(F):5'- CATGAACTCTGTGAAGGAATGGTCC -3'
(R):5'- TGACATGGCAGTCCCCTCC -3'
Posted On2018-05-04