Mutagenetix > Incidental Mutation

Incidental Mutation 'R6394:Kif13a'

515974

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R6394 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46749087-46929867 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46752455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 671 (V671M)

Ref Sequence

ENSEMBL: ENSMUSP00000153657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056978
AA Change: V1619M

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: V1619M

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223881
AA Change: V671M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

Meta Mutation Damage Score

0.0761

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,921,792	L174*	probably null	Het
Akap11	A	T	14: 78,522,589		probably null	Het
Alpi	T	A	1: 87,100,706	Y154F	possibly damaging	Het
Als2	A	T	1: 59,167,197	F1635I	probably damaging	Het
Anxa1	C	T	19: 20,383,849	V60M	probably damaging	Het
Atp10b	A	G	11: 43,225,637	Y937C	probably damaging	Het
Brd4	C	A	17: 32,224,147	E167*	probably null	Het
Cacna1h	G	A	17: 25,387,481	T1048I	probably benign	Het
Ccdc113	A	G	8: 95,557,192	D298G	probably benign	Het
Cfap100	T	A	6: 90,417,623	N74I	possibly damaging	Het
Chd8	A	T	14: 52,202,585	H4Q	possibly damaging	Het
Clcn1	A	G	6: 42,307,590	T621A	possibly damaging	Het
Clcn1	A	G	6: 42,313,238	T843A	possibly damaging	Het
Clcn3	C	T	8: 60,941,291	R68Q	probably damaging	Het
Dcaf13	T	A	15: 39,143,737	N355K	probably benign	Het
Dnah6	A	T	6: 73,155,418	C1100*	probably null	Het
Dync2h1	A	T	9: 7,168,331	V428E	probably damaging	Het
E230025N22Rik	T	C	18: 36,686,786	E317G	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Evc2	C	A	5: 37,378,275	D431E	probably damaging	Het
Gcm2	T	G	13: 41,109,897	T20P	probably damaging	Het
Gdf9	A	G	11: 53,436,697	Y160C	probably damaging	Het
Gm8220	A	G	14: 44,285,677		probably benign	Het
Gm9573	A	T	17: 35,620,166		probably benign	Het
Gpalpp1	A	T	14: 76,107,412	S44T	possibly damaging	Het
Grip2	T	C	6: 91,787,201	Y134C	probably damaging	Het
Hephl1	A	G	9: 15,074,101	F753S	probably benign	Het
Herc1	A	G	9: 66,395,059	T727A	probably damaging	Het
Herc2	A	G	7: 56,215,981	E4232G	probably damaging	Het
Ifi207	A	G	1: 173,729,015	L726P	probably benign	Het
Itga11	T	A	9: 62,735,266		probably null	Het
Jrkl	A	C	9: 13,245,490	Y55*	probably null	Het
Kif18b	A	G	11: 102,914,410	V303A	probably damaging	Het
Klhl29	A	T	12: 5,094,830	C423*	probably null	Het
Klhl29	T	C	12: 5,137,720	S215G	probably benign	Het
Lamp5	A	G	2: 136,061,009	D216G	possibly damaging	Het
Leo1	T	A	9: 75,445,470	D98E	probably benign	Het
Map3k3	T	C	11: 106,148,883	V283A	probably benign	Het
Med12l	A	G	3: 59,235,087	K902E	probably damaging	Het
Mmp1b	C	A	9: 7,386,316	D202Y	probably benign	Het
Olfr1201	C	T	2: 88,794,952	T190I	probably benign	Het
Olfr239	G	A	17: 33,199,513	G155D	probably damaging	Het
Olfr488	C	T	7: 108,255,763	R125H	possibly damaging	Het
Olfr657	T	A	7: 104,635,702	N9K	possibly damaging	Het
Olfr657	T	C	7: 104,636,027	S118P	possibly damaging	Het
Olfr816	G	T	10: 129,911,920	D119E	probably damaging	Het
Olfr979	T	C	9: 40,000,705	Q174R	probably benign	Het
Onecut3	A	G	10: 80,496,013	I336V	probably damaging	Het
Oprl1	C	T	2: 181,719,002	R257C	probably damaging	Het
Osbpl6	T	C	2: 76,555,954	V207A	probably benign	Het
Pde3a	A	T	6: 141,487,511	H756L	probably damaging	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phyh	A	G	2: 4,936,003	D238G	probably benign	Het
Pnliprp2	T	A	19: 58,761,598	N92K	probably benign	Het
Pole3	T	C	4: 62,524,026		probably benign	Het
Ppm1d	T	C	11: 85,339,672	V372A	probably benign	Het
Prpf40a	A	T	2: 53,144,878	I766N	probably damaging	Het
Prr5	T	A	15: 84,699,724	V175E	probably damaging	Het
Ptprq	T	A	10: 107,642,943	K1280*	probably null	Het
Rbp2	T	A	9: 98,507,820	V95E	possibly damaging	Het
Rictor	T	C	15: 6,769,309	F346L	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Scn10a	T	A	9: 119,661,320	I519F	probably benign	Het
Setd5	T	G	6: 113,115,544	V295G	probably damaging	Het
Shcbp1	A	T	8: 4,736,176	M642K	probably damaging	Het
Slc13a3	C	T	2: 165,434,097	G243E	probably damaging	Het
Smg9	T	C	7: 24,422,307	Y498H	probably damaging	Het
Sox5	T	C	6: 144,041,313	D175G	probably damaging	Het
Stard7	A	G	2: 127,284,241	D71G	probably damaging	Het
Stxbp5	A	T	10: 9,899,231	Y59*	probably null	Het
Supt6	G	A	11: 78,231,065	R254C	probably damaging	Het
Syne2	C	T	12: 75,990,495	T3817I	probably benign	Het
Tas2r124	T	A	6: 132,755,076	I116N	probably damaging	Het
Trim9	T	A	12: 70,255,213	E550D	possibly damaging	Het
Vmn2r50	A	G	7: 10,040,326	S548P	probably damaging	Het
Zmynd8	C	A	2: 165,846,023	E126*	probably null	Het
Zswim9	A	T	7: 13,260,963	S422R	probably damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46750634	splice site	probably benign
IGL01433:Kif13a	APN	13	46772908	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	46864837	splice site	probably benign
IGL01536:Kif13a	APN	13	46752289	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	46864820	missense	probably benign
IGL02020:Kif13a	APN	13	46794019	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46771535	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46825222	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46785293	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46785296	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46772838	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46752088	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46764623	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46786511	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0135:Kif13a	UTSW	13	46793943	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46764603	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46791351	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46814219	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46791401	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46802711	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46778888	unclassified	probably benign
R0654:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	46848337	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46799213	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46812823	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46814236	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	46929259	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46825235	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46791511	splice site	probably benign
R1449:Kif13a	UTSW	13	46812736	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	46929612	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46809213	missense	probably benign
R1579:Kif13a	UTSW	13	46752856	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46793922	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46793922	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46798409	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46752613	missense	possibly damaging	0.73
R1755:Kif13a	UTSW	13	46773678	missense	possibly damaging	0.50
R1858:Kif13a	UTSW	13	46864838	splice site	probably benign
R1891:Kif13a	UTSW	13	46929219	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46788162	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46812745	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	46864838	splice site	probably benign
R1961:Kif13a	UTSW	13	46864838	splice site	probably benign
R2016:Kif13a	UTSW	13	46810799	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46752469	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46769176	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46777097	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46814200	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46764596	splice site	probably benign
R3499:Kif13a	UTSW	13	46825339	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46802690	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46814155	splice site	probably null
R4771:Kif13a	UTSW	13	46825211	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46826748	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	46929599	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46809055	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46777163	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46788085	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46802646	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46752721	missense	probably benign
R5329:Kif13a	UTSW	13	46775401	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46772769	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46832736	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46752115	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46752862	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46825300	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46771524	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46801313	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46826757	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46815207	splice site	probably null
R6393:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46809156	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46826745	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46750613	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46798479	missense	probably benign
R8098:Kif13a	UTSW	13	46815304	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46778968	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46752581	missense	probably benign	0.01
R8806:Kif13a	UTSW	13	46761337	missense	possibly damaging	0.49
R8871:Kif13a	UTSW	13	46830803	missense	probably damaging	1.00
R8877:Kif13a	UTSW	13	46801445	critical splice acceptor site	probably null
R8906:Kif13a	UTSW	13	46773678	missense	probably benign	0.17
R9028:Kif13a	UTSW	13	46798365	missense	probably damaging	1.00
R9058:Kif13a	UTSW	13	46791465	missense	probably damaging	1.00
R9062:Kif13a	UTSW	13	46788060	missense	possibly damaging	0.91
R9070:Kif13a	UTSW	13	46752458	missense	probably benign	0.00
R9083:Kif13a	UTSW	13	46812787	missense	probably damaging	1.00
R9250:Kif13a	UTSW	13	46775433	missense	probably damaging	1.00
R9328:Kif13a	UTSW	13	46798362	missense	probably damaging	1.00
R9360:Kif13a	UTSW	13	46808996	missense	probably benign	0.01
R9369:Kif13a	UTSW	13	46786623	missense	probably damaging	0.99
R9589:Kif13a	UTSW	13	46802544	missense	not run
X0013:Kif13a	UTSW	13	46929270	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- AACACCCATGAACTCTGTGAAGG -3'
(R):5'- TCTGTCTGACATGGCAGTCC -3'

Sequencing Primer
(F):5'- CATGAACTCTGTGAAGGAATGGTCC -3'
(R):5'- TGACATGGCAGTCCCCTCC -3'

Posted On

2018-05-04