Incidental Mutation 'R6396:Rrp15'
ID515990
Institutional Source Beutler Lab
Gene Symbol Rrp15
Ensembl Gene ENSMUSG00000001305
Gene Nameribosomal RNA processing 15 homolog (S. cerevisiae)
Synonyms2810430M08Rik, 5430437H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location186720978-186749358 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 186737586 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001339]
Predicted Effect probably null
Transcript: ENSMUST00000001339
SMART Domains Protein: ENSMUSP00000001339
Gene: ENSMUSG00000001305

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
Pfam:Rrp15p 92 215 3e-32 PFAM
low complexity region 264 279 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162336
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a protein similar to budding yeast Rrp15p. Rrp15p is a component of pre-60S ribosomal particles in budding yeast, and is required for the early maturation steps of the 60S subunit. The mouse genome contains at least one pseudogene on the X chromosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Rrp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Rrp15 APN 1 186721548 critical splice acceptor site probably null
IGL02285:Rrp15 APN 1 186721395 utr 3 prime probably benign
R0413:Rrp15 UTSW 1 186749149 splice site probably benign
R0548:Rrp15 UTSW 1 186736234 missense probably benign 0.01
R1449:Rrp15 UTSW 1 186736268 missense possibly damaging 0.61
R1966:Rrp15 UTSW 1 186736205 missense possibly damaging 0.46
R5318:Rrp15 UTSW 1 186721546 missense probably benign 0.00
R5982:Rrp15 UTSW 1 186739755 missense possibly damaging 0.93
R6287:Rrp15 UTSW 1 186749176 missense probably benign 0.12
R7176:Rrp15 UTSW 1 186721533 missense probably benign 0.02
R7822:Rrp15 UTSW 1 186749176 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGCGACCCAAGCAGATTCAG -3'
(R):5'- AGGGTGCTTTATTACCTCCGTC -3'

Sequencing Primer
(F):5'- GATTCAGATCAAATACACACTCGGTG -3'
(R):5'- ACAGATCCTATCAGAGTTTGCTGC -3'
Posted On2018-05-04