Incidental Mutation 'R6396:Olfr613'
ID516004
Institutional Source Beutler Lab
Gene Symbol Olfr613
Ensembl Gene ENSMUSG00000078624
Gene Nameolfactory receptor 613
SynonymsMOR20-1, Olfr614, GA_x6K02T2PBJ9-6271959-6272393, GA_x6K02T2PBJ9-6275524-6276477, MOR20-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103548074-103555506 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 103552681 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 299 (Q299*)
Ref Sequence ENSEMBL: ENSMUSP00000149332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106888] [ENSMUST00000214173] [ENSMUST00000214345] [ENSMUST00000215673]
Predicted Effect probably null
Transcript: ENSMUST00000106888
AA Change: Q299*
SMART Domains Protein: ENSMUSP00000102501
Gene: ENSMUSG00000078624
AA Change: Q299*

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 1.1e-99 PFAM
Pfam:7tm_1 42 293 5.6e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214173
AA Change: Q299*
Predicted Effect probably benign
Transcript: ENSMUST00000214345
Predicted Effect probably benign
Transcript: ENSMUST00000215673
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Olfr613
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr613 APN 7 103551857 missense probably damaging 0.99
IGL03009:Olfr613 APN 7 103552527 nonsense probably null
R0047:Olfr613 UTSW 7 103552322 missense probably damaging 1.00
R0047:Olfr613 UTSW 7 103552322 missense probably damaging 1.00
R1559:Olfr613 UTSW 7 103552165 missense possibly damaging 0.82
R2247:Olfr613 UTSW 7 103551890 unclassified probably null
R4622:Olfr613 UTSW 7 103552154 missense probably benign 0.00
R4674:Olfr613 UTSW 7 103551976 missense probably damaging 1.00
R4675:Olfr613 UTSW 7 103551976 missense probably damaging 1.00
R5101:Olfr613 UTSW 7 103551943 missense probably damaging 1.00
R6860:Olfr613 UTSW 7 103551868 missense probably benign
R7310:Olfr613 UTSW 7 103552685 missense probably damaging 1.00
R7318:Olfr613 UTSW 7 103552091 missense probably damaging 0.98
R7593:Olfr613 UTSW 7 103551749 unclassified probably benign
R8046:Olfr613 UTSW 7 103552377 missense possibly damaging 0.90
R8138:Olfr613 UTSW 7 103552059 missense probably benign 0.22
R8243:Olfr613 UTSW 7 103551998 missense not run
Predicted Primers PCR Primer
(F):5'- TGATGAAACTGGGGATCCAAGATC -3'
(R):5'- TCCTTATTTGAGGGAATGAGTACTG -3'

Sequencing Primer
(F):5'- GAAATCCCTGCAAACCTGTGTCTG -3'
(R):5'- TGTTTAATGTTAGAACTCATGGTGTC -3'
Posted On2018-05-04