Incidental Mutation 'R6396:Skor1'
ID516007
Institutional Source Beutler Lab
Gene Symbol Skor1
Ensembl Gene ENSMUSG00000022245
Gene NameSKI family transcriptional corepressor 1
SynonymsCorl1, C230094B15Rik, Lbxcor1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location63138170-63148961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63144950 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 579 (P579Q)
Ref Sequence ENSEMBL: ENSMUSP00000055037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055281] [ENSMUST00000116613] [ENSMUST00000119146]
Predicted Effect probably damaging
Transcript: ENSMUST00000055281
AA Change: P579Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055037
Gene: ENSMUSG00000022245
AA Change: P579Q

DomainStartEndE-ValueType
Pfam:Ski_Sno 61 168 3.2e-41 PFAM
c-SKI_SMAD_bind 180 272 2.48e-56 SMART
low complexity region 284 312 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
low complexity region 345 366 N/A INTRINSIC
low complexity region 379 398 N/A INTRINSIC
low complexity region 414 454 N/A INTRINSIC
low complexity region 465 479 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 568 582 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
SCOP:d1eq1a_ 850 937 1e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116613
AA Change: P540Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112312
Gene: ENSMUSG00000022245
AA Change: P540Q

DomainStartEndE-ValueType
Pfam:Ski_Sno 17 130 3.5e-42 PFAM
c-SKI_SMAD_bind 141 233 2.48e-56 SMART
low complexity region 245 273 N/A INTRINSIC
low complexity region 294 303 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
low complexity region 340 359 N/A INTRINSIC
low complexity region 375 415 N/A INTRINSIC
low complexity region 426 440 N/A INTRINSIC
low complexity region 463 486 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
SCOP:d1eq1a_ 811 898 1e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119146
AA Change: P551Q

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113924
Gene: ENSMUSG00000022245
AA Change: P551Q

DomainStartEndE-ValueType
Pfam:Ski_Sno 28 141 3e-42 PFAM
c-SKI_SMAD_bind 152 244 2.48e-56 SMART
low complexity region 256 284 N/A INTRINSIC
low complexity region 305 314 N/A INTRINSIC
low complexity region 317 338 N/A INTRINSIC
low complexity region 351 370 N/A INTRINSIC
low complexity region 386 426 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
low complexity region 474 497 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
SCOP:d1eq1a_ 822 909 1e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Skor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Skor1 APN 9 63146441 missense probably damaging 1.00
IGL00736:Skor1 APN 9 63139538 missense probably damaging 0.99
IGL01344:Skor1 APN 9 63142278 missense possibly damaging 0.79
IGL01383:Skor1 APN 9 63146556 missense probably benign 0.12
IGL01456:Skor1 APN 9 63145490 missense probably damaging 1.00
IGL02503:Skor1 APN 9 63146115 missense probably damaging 1.00
IGL02526:Skor1 APN 9 63145877 missense probably damaging 1.00
IGL02699:Skor1 APN 9 63140046 splice site probably benign
R0041:Skor1 UTSW 9 63145851 missense probably damaging 1.00
R0092:Skor1 UTSW 9 63145995 missense probably damaging 1.00
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1581:Skor1 UTSW 9 63146223 missense probably damaging 1.00
R1598:Skor1 UTSW 9 63146004 missense probably damaging 1.00
R2172:Skor1 UTSW 9 63145122 missense possibly damaging 0.84
R3734:Skor1 UTSW 9 63140068 missense probably damaging 1.00
R3803:Skor1 UTSW 9 63145586 missense probably benign 0.06
R3839:Skor1 UTSW 9 63144448 missense probably damaging 0.97
R4627:Skor1 UTSW 9 63145476 missense probably damaging 1.00
R4698:Skor1 UTSW 9 63144548 missense probably benign
R4712:Skor1 UTSW 9 63139573 splice site probably null
R4781:Skor1 UTSW 9 63144459 missense probably benign
R5089:Skor1 UTSW 9 63145923 missense probably damaging 0.99
R5735:Skor1 UTSW 9 63146064 missense probably damaging 1.00
R6279:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6300:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6791:Skor1 UTSW 9 63140354 splice site probably null
R7371:Skor1 UTSW 9 63146887 splice site probably null
R7448:Skor1 UTSW 9 63146103 missense probably damaging 1.00
R7491:Skor1 UTSW 9 63146448 missense probably damaging 0.99
R7496:Skor1 UTSW 9 63146850 missense probably benign 0.02
R7606:Skor1 UTSW 9 63145382 missense probably damaging 1.00
R7664:Skor1 UTSW 9 63141763 missense probably benign 0.08
R7689:Skor1 UTSW 9 63145379 missense probably damaging 1.00
R7793:Skor1 UTSW 9 63144885 missense probably damaging 1.00
R7871:Skor1 UTSW 9 63146501 missense probably damaging 1.00
R7911:Skor1 UTSW 9 63145046 missense possibly damaging 0.50
R7954:Skor1 UTSW 9 63146501 missense probably damaging 1.00
R7992:Skor1 UTSW 9 63145046 missense possibly damaging 0.50
Z1176:Skor1 UTSW 9 63145130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCGGTTGGACTCTACGTC -3'
(R):5'- TATACCCGACGTTTCCCATG -3'

Sequencing Primer
(F):5'- TGCCCTCGCTCAGAAAGTC -3'
(R):5'- ATGTTCTGGCCAGCAGC -3'
Posted On2018-05-04