Incidental Mutation 'R6396:Pank3'
ID516009
Institutional Source Beutler Lab
Gene Symbol Pank3
Ensembl Gene ENSMUSG00000018846
Gene Namepantothenate kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location35769484-35791285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35778689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 250 (V250A)
Ref Sequence ENSEMBL: ENSMUSP00000018990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018990]
Predicted Effect probably damaging
Transcript: ENSMUST00000018990
AA Change: V250A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018990
Gene: ENSMUSG00000018846
AA Change: V250A

DomainStartEndE-ValueType
Pfam:Fumble 13 365 1e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083619
Meta Mutation Damage Score 0.9348 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is expressed most abundantly in the liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele in combination with either a knock-out of Pank1 or Pank2 exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Pank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03109:Pank3 APN 11 35777674 missense probably benign 0.04
R0217:Pank3 UTSW 11 35777728 missense probably benign
R0243:Pank3 UTSW 11 35781716 splice site probably benign
R0454:Pank3 UTSW 11 35777709 missense probably benign
R0662:Pank3 UTSW 11 35778650 missense probably damaging 0.96
R1522:Pank3 UTSW 11 35781681 missense probably benign 0.45
R2246:Pank3 UTSW 11 35783506 missense probably benign 0.00
R6905:Pank3 UTSW 11 35776412 missense probably benign 0.01
R8143:Pank3 UTSW 11 35776209 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGGTTTGGTTCTACTAAGTAGTC -3'
(R):5'- TGCTCCTCCACTGAGAAATATC -3'

Sequencing Primer
(F):5'- CACATTGGTGTTTAGCATTTACCATG -3'
(R):5'- GCTGATTGTGCCATAACTAGC -3'
Posted On2018-05-04