Incidental Mutation 'R6396:Olfr51'
ID516010
Institutional Source Beutler Lab
Gene Symbol Olfr51
Ensembl Gene ENSMUSG00000060918
Gene Nameolfactory receptor 51
SynonymsMOR129-3, ID7, GA_x6K02T2QP88-4431129-4430206
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location51003596-51009676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51007485 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 171 (H171R)
Ref Sequence ENSEMBL: ENSMUSP00000151005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076514] [ENSMUST00000213415]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076514
AA Change: H171R

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075832
Gene: ENSMUSG00000060918
AA Change: H171R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.4e-50 PFAM
Pfam:7tm_1 41 289 8.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213415
AA Change: H171R

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Olfr51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Olfr51 APN 11 51007766 missense probably benign 0.15
IGL02729:Olfr51 APN 11 51007065 missense probably damaging 1.00
R0367:Olfr51 UTSW 11 51007077 missense probably damaging 1.00
R1675:Olfr51 UTSW 11 51007637 missense probably benign 0.01
R1716:Olfr51 UTSW 11 51007852 missense probably damaging 1.00
R1943:Olfr51 UTSW 11 51007675 missense probably benign 0.42
R3027:Olfr51 UTSW 11 51007052 missense possibly damaging 0.77
R4569:Olfr51 UTSW 11 51007554 missense possibly damaging 0.94
R5190:Olfr51 UTSW 11 51007554 missense probably damaging 0.98
R5447:Olfr51 UTSW 11 51007343 missense possibly damaging 0.66
R5560:Olfr51 UTSW 11 51007523 missense possibly damaging 0.61
R6943:Olfr51 UTSW 11 51007326 missense probably damaging 1.00
R7199:Olfr51 UTSW 11 51007396 nonsense probably null
R8118:Olfr51 UTSW 11 51007500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGCAATATGGATGGCTTCC -3'
(R):5'- GTCGACAGGGCTTTCCTTATTC -3'

Sequencing Primer
(F):5'- CAATATGGATGGCTTCCTCCTGAG -3'
(R):5'- CCATGGGCAGATTTTAACTTCAG -3'
Posted On2018-05-04