Mutagenetix > Incidental Mutation

Incidental Mutation 'R6396:Heatr1'

516012

Institutional Source

Beutler Lab

Gene Symbol

Heatr1

Ensembl Gene

ENSMUSG00000050244

Gene Name

HEAT repeat containing 1

Synonyms

B130016L12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R6396 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12395027-12440289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12406097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 423 (E423G)

Ref Sequence

ENSEMBL: ENSMUSP00000054084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000221046]

AlphaFold

G3X9B1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059270
AA Change: E423G

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: E423G

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Pfam:U3snoRNP10	238	354	7e-30	PFAM
SCOP:d1qbkb_	919	1795	3e-8	SMART
low complexity region	1805	1814	N/A	INTRINSIC
BP28CT	1856	2009	2.25e-77	SMART
Blast:BP28CT	2015	2061	2e-15	BLAST
coiled coil region	2109	2137	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221046

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 97.9%

Validation Efficiency

100% (36/36)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	G	6: 149,327,919	D821G	probably damaging	Het
Arhgap35	A	T	7: 16,562,299	I947K	probably damaging	Het
B3galnt2	A	T	13: 13,995,748	I447F	probably damaging	Het
Cacna2d3	C	A	14: 29,396,565	V134L	probably benign	Het
Clcn4	C	T	7: 7,294,025	G145S	probably damaging	Het
Cndp1	A	T	18: 84,632,010	M186K	probably benign	Het
Cntn6	A	G	6: 104,650,500	Y98C	probably damaging	Het
Ctsb	T	C	14: 63,138,101	V172A	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dyrk1a	C	A	16: 94,671,440	Q230K	probably damaging	Het
Ech1	C	T	7: 28,830,338		probably null	Het
Fam81b	T	A	13: 76,251,849	R97W	probably damaging	Het
Hydin	A	T	8: 110,506,889	K1786N	probably damaging	Het
Igf2r	T	C	17: 12,714,090	I848M	probably benign	Het
Igkv10-96	G	A	6: 68,631,985	Q109*	probably null	Het
Mup6	T	C	4: 60,004,837	I76T	possibly damaging	Het
Nmt2	A	G	2: 3,314,701	R243G	probably benign	Het
Nsd1	G	A	13: 55,238,789	G119D	probably damaging	Het
Olfr1218	A	G	2: 89,055,297	I43T	probably benign	Het
Olfr1225	T	G	2: 89,170,690	D174A	probably damaging	Het
Olfr51	A	G	11: 51,007,485	H171R	possibly damaging	Het
Olfr613	C	T	7: 103,552,681	Q299*	probably null	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pank3	T	C	11: 35,778,689	V250A	probably damaging	Het
Pcdh10	A	G	3: 45,380,060	I270V	possibly damaging	Het
Pnp2	T	A	14: 50,963,159	V94E	probably damaging	Het
Prdm10	T	C	9: 31,318,546	V86A	possibly damaging	Het
Riox1	G	A	12: 83,951,313	D208N	possibly damaging	Het
Rrp15	A	G	1: 186,737,586		probably null	Het
Skor1	G	T	9: 63,144,950	P579Q	probably damaging	Het
Slc44a4	T	A	17: 34,928,884	Y481*	probably null	Het
Smg7	A	T	1: 152,848,600	V610E	probably benign	Het
Tlx1	A	G	19: 45,156,052	Q71R	probably damaging	Het
Vmn2r27	A	T	6: 124,224,166	Y277*	probably null	Het
Zswim2	T	A	2: 83,923,718	R199S	probably damaging	Het

Other mutations in Heatr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Heatr1	APN	13	12410450	missense	probably benign	0.00
IGL00863:Heatr1	APN	13	12435128	missense	probably benign	0.02
IGL00899:Heatr1	APN	13	12435176	missense	probably benign	0.31
IGL01147:Heatr1	APN	13	12437912	missense	probably damaging	0.99
IGL01317:Heatr1	APN	13	12399027	missense	probably damaging	1.00
IGL01323:Heatr1	APN	13	12398938	missense	possibly damaging	0.86
IGL01625:Heatr1	APN	13	12413528	missense	probably damaging	0.98
IGL01973:Heatr1	APN	13	12429799	missense	probably benign
IGL02803:Heatr1	APN	13	12433986	missense	probably damaging	0.96
IGL02830:Heatr1	APN	13	12426212	missense	possibly damaging	0.57
IGL02956:Heatr1	APN	13	12416059	missense	possibly damaging	0.53
IGL03000:Heatr1	APN	13	12434411	missense	probably damaging	0.99
IGL03024:Heatr1	APN	13	12407509	unclassified	probably benign
IGL03035:Heatr1	APN	13	12413219	splice site	probably benign
IGL03301:Heatr1	APN	13	12434205	missense	probably damaging	1.00
hasan	UTSW	13	12417447	splice site	probably benign
H8562:Heatr1	UTSW	13	12408713	missense	probably benign	0.13
R0226:Heatr1	UTSW	13	12410562	missense	probably damaging	1.00
R0571:Heatr1	UTSW	13	12430240	missense	probably damaging	0.98
R0722:Heatr1	UTSW	13	12406037	missense	probably benign	0.14
R1264:Heatr1	UTSW	13	12424610	unclassified	probably benign
R1371:Heatr1	UTSW	13	12417632	missense	possibly damaging	0.80
R1388:Heatr1	UTSW	13	12417447	splice site	probably benign
R1396:Heatr1	UTSW	13	12406046	missense	possibly damaging	0.86
R1519:Heatr1	UTSW	13	12412159	missense	probably benign
R1689:Heatr1	UTSW	13	12424625	missense	probably benign	0.00
R1696:Heatr1	UTSW	13	12423721	missense	possibly damaging	0.96
R1756:Heatr1	UTSW	13	12396460	missense	probably benign	0.01
R1859:Heatr1	UTSW	13	12403159	missense	probably damaging	1.00
R1932:Heatr1	UTSW	13	12435185	missense	probably damaging	1.00
R1957:Heatr1	UTSW	13	12396538	missense	probably damaging	1.00
R2018:Heatr1	UTSW	13	12414478	missense	possibly damaging	0.68
R2106:Heatr1	UTSW	13	12412058	missense	probably benign	0.03
R2119:Heatr1	UTSW	13	12432646	missense	probably null	1.00
R2121:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2122:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2367:Heatr1	UTSW	13	12433724	missense	probably damaging	1.00
R3777:Heatr1	UTSW	13	12413348	missense	possibly damaging	0.92
R3783:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3784:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3786:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3787:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3843:Heatr1	UTSW	13	12435121	missense	probably benign	0.00
R4533:Heatr1	UTSW	13	12434511	missense	probably benign	0.05
R4725:Heatr1	UTSW	13	12424662	nonsense	probably null
R4763:Heatr1	UTSW	13	12430930	missense	possibly damaging	0.65
R4793:Heatr1	UTSW	13	12431837	missense	probably benign	0.00
R4797:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4798:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4942:Heatr1	UTSW	13	12413510	critical splice acceptor site	probably null
R4952:Heatr1	UTSW	13	12410599	missense	probably benign	0.38
R4954:Heatr1	UTSW	13	12407516	critical splice acceptor site	probably null
R5370:Heatr1	UTSW	13	12401522	missense	probably benign	0.02
R5464:Heatr1	UTSW	13	12433643	missense	probably benign	0.00
R5483:Heatr1	UTSW	13	12398914	missense	probably damaging	1.00
R5497:Heatr1	UTSW	13	12421064	missense	possibly damaging	0.93
R5504:Heatr1	UTSW	13	12406619	missense	possibly damaging	0.64
R5527:Heatr1	UTSW	13	12402760	missense	probably damaging	1.00
R5527:Heatr1	UTSW	13	12404948	missense	probably benign
R5836:Heatr1	UTSW	13	12408736	missense	probably damaging	0.99
R5916:Heatr1	UTSW	13	12434471	missense	probably damaging	1.00
R6018:Heatr1	UTSW	13	12404947	missense	probably benign
R6018:Heatr1	UTSW	13	12406058	missense	probably benign	0.26
R6216:Heatr1	UTSW	13	12432664	missense	probably benign	0.16
R6472:Heatr1	UTSW	13	12434230	missense	probably benign	0.29
R6922:Heatr1	UTSW	13	12435075	missense	probably benign	0.00
R7077:Heatr1	UTSW	13	12418164	missense	possibly damaging	0.63
R7297:Heatr1	UTSW	13	12421060	nonsense	probably null
R7445:Heatr1	UTSW	13	12431038	missense	possibly damaging	0.70
R7669:Heatr1	UTSW	13	12411262	missense	probably benign	0.33
R7672:Heatr1	UTSW	13	12438664	missense	probably damaging	0.96
R7772:Heatr1	UTSW	13	12417641	missense	probably benign	0.03
R8205:Heatr1	UTSW	13	12416047	missense	probably benign
R8518:Heatr1	UTSW	13	12410534	missense	probably benign
R8754:Heatr1	UTSW	13	12413294	missense	probably damaging	0.99
R8874:Heatr1	UTSW	13	12430912	missense	probably damaging	1.00
R8992:Heatr1	UTSW	13	12401114	missense	probably damaging	0.98
R9045:Heatr1	UTSW	13	12413352	missense	probably benign	0.00
R9077:Heatr1	UTSW	13	12413366	missense	probably benign
R9183:Heatr1	UTSW	13	12421385	missense	probably damaging	0.99
R9186:Heatr1	UTSW	13	12421346	missense	probably damaging	1.00
R9223:Heatr1	UTSW	13	12404921	missense	probably benign	0.00
R9242:Heatr1	UTSW	13	12433925	missense	probably benign
R9267:Heatr1	UTSW	13	12406608	missense	probably damaging	1.00
R9289:Heatr1	UTSW	13	12432727	missense	probably benign	0.13
R9310:Heatr1	UTSW	13	12438610	missense	probably benign
R9312:Heatr1	UTSW	13	12431684	missense	probably benign
R9358:Heatr1	UTSW	13	12418206	missense	probably benign	0.09
R9385:Heatr1	UTSW	13	12406542	missense	probably damaging	1.00
R9530:Heatr1	UTSW	13	12424726	missense	probably damaging	1.00
R9532:Heatr1	UTSW	13	12414425	missense	possibly damaging	0.72
R9647:Heatr1	UTSW	13	12426798	missense	probably benign	0.00
R9683:Heatr1	UTSW	13	12434259	missense	probably damaging	1.00
R9695:Heatr1	UTSW	13	12423743	missense	probably damaging	1.00
RF011:Heatr1	UTSW	13	12407544	missense	probably benign	0.00
Z1176:Heatr1	UTSW	13	12399008	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AGAAAGGGTCACTAGTGTTGCTTTG -3'
(R):5'- TGTCCACAAACCTTCTACAGTC -3'

Sequencing Primer
(F):5'- GCGTTTGACCTCAGACAAATTGG -3'
(R):5'- ACAAACCTTCTACAGTCCTATTTCC -3'

Posted On

2018-05-04