Incidental Mutation 'R6396:Fam81b'
ID516015
Institutional Source Beutler Lab
Gene Symbol Fam81b
Ensembl Gene ENSMUSG00000109228
Gene Namefamily with sequence similarity 81, member B
SynonymsLOC238726
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location76201708-76305072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76251849 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 97 (R97W)
Ref Sequence ENSEMBL: ENSMUSP00000146649 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208418
AA Change: R97W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225095
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Fam81b
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4589:Fam81b UTSW 13 76271323 small insertion probably benign
FR4737:Fam81b UTSW 13 76271319 small insertion probably benign
R6684:Fam81b UTSW 13 76202038 nonsense probably null
R7492:Fam81b UTSW 13 76271279 missense probably benign 0.01
R7671:Fam81b UTSW 13 76271293 missense probably damaging 0.97
R7671:Fam81b UTSW 13 76271294 missense possibly damaging 0.94
R7742:Fam81b UTSW 13 76251690 missense probably damaging 1.00
R8147:Fam81b UTSW 13 76235021 missense probably damaging 1.00
RF009:Fam81b UTSW 13 76271316 small insertion probably benign
RF011:Fam81b UTSW 13 76271316 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTTGACGATGCTGGTGA -3'
(R):5'- TTAGTTCAGGCTCCTAGTGTCT -3'

Sequencing Primer
(F):5'- ACGATGCTGGTGATGGTC -3'
(R):5'- AGGATGTAATGCTCTCAGCTACC -3'
Posted On2018-05-04