Incidental Mutation 'R6396:Pnp2'
ID516017
Institutional Source Beutler Lab
Gene Symbol Pnp2
Ensembl Gene ENSMUSG00000068417
Gene Namepurine-nucleoside phosphorylase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50955992-50964749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50963159 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 94 (V94E)
Ref Sequence ENSEMBL: ENSMUSP00000093615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095925] [ENSMUST00000178092] [ENSMUST00000227052]
Predicted Effect probably damaging
Transcript: ENSMUST00000095925
AA Change: V94E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093615
Gene: ENSMUSG00000068417
AA Change: V94E

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 41 295 4.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178092
SMART Domains Protein: ENSMUSP00000136557
Gene: ENSMUSG00000115338

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228593
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Pnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Pnp2 APN 14 50959553 missense probably damaging 1.00
IGL02418:Pnp2 APN 14 50963836 missense possibly damaging 0.51
IGL03216:Pnp2 APN 14 50963197 missense probably benign 0.01
IGL03388:Pnp2 APN 14 50963538 missense probably damaging 1.00
R0049:Pnp2 UTSW 14 50959533 nonsense probably null
R0097:Pnp2 UTSW 14 50963501 missense probably benign 0.08
R0123:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0134:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0158:Pnp2 UTSW 14 50964304 missense probably damaging 1.00
R1477:Pnp2 UTSW 14 50959535 missense probably benign 0.35
R1820:Pnp2 UTSW 14 50964457 missense possibly damaging 0.93
R1934:Pnp2 UTSW 14 50956218 missense probably benign
R2138:Pnp2 UTSW 14 50963704 missense probably damaging 1.00
R3843:Pnp2 UTSW 14 50963421 missense probably null 1.00
R4355:Pnp2 UTSW 14 50959625 missense probably benign
R4938:Pnp2 UTSW 14 50963568 splice site probably null
R5516:Pnp2 UTSW 14 50963738 missense probably benign 0.33
R5636:Pnp2 UTSW 14 50956192 intron probably null
R7117:Pnp2 UTSW 14 50964474 makesense probably null
R7862:Pnp2 UTSW 14 50963559 missense possibly damaging 0.95
R7945:Pnp2 UTSW 14 50963559 missense possibly damaging 0.95
R8057:Pnp2 UTSW 14 50964381 missense probably benign 0.06
R8104:Pnp2 UTSW 14 50959642 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATACAGGGAAGTATGCTTGC -3'
(R):5'- ACTCTCACTGGGAATGTCACC -3'

Sequencing Primer
(F):5'- CAGTCTAGGCTGGCCTTGAAC -3'
(R):5'- CACTGGGAATGTCACCTTAGATGC -3'
Posted On2018-05-04