Incidental Mutation 'R6396:Ctsb'
ID516018
Institutional Source Beutler Lab
Gene Symbol Ctsb
Ensembl Gene ENSMUSG00000021939
Gene Namecathepsin B
SynonymsCB
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location63122462-63145923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63138101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000006235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006235]
Predicted Effect probably benign
Transcript: ENSMUST00000006235
AA Change: V172A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000006235
Gene: ENSMUSG00000021939
AA Change: V172A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Propeptide_C1 26 65 5.4e-22 PFAM
Pept_C1 80 329 1.12e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225540
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin B light and heavy chains, which can dimerize to generate the double chain form of the enzyme. This enzyme is a lysosomal cysteine protease with both endopeptidase and exopeptidase activity that may play a role in protein turnover. Homozygous knockout mice for this gene exhibit reduced pancreatic damage following induced pancreatitis and reduced hepatocyte apoptosis in a model of liver injury. Pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are born normal without gross abnormalities. Homozygous mutant has resistance to induced pancreatitis. In combination with Ctsltm1Cptr, double homozygous mutant shows postnatal lethality due to wide neuronal degeneration in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Ctsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Ctsb APN 14 63135650 missense probably damaging 0.99
IGL02565:Ctsb APN 14 63138410 missense probably null 1.00
IGL03011:Ctsb APN 14 63133357 missense probably benign 0.13
R0001:Ctsb UTSW 14 63135622 missense probably benign 0.00
R1226:Ctsb UTSW 14 63141740 missense probably damaging 1.00
R1241:Ctsb UTSW 14 63139104 missense probably benign 0.28
R1533:Ctsb UTSW 14 63139095 missense probably damaging 1.00
R4179:Ctsb UTSW 14 63133452 missense probably benign 0.01
R6042:Ctsb UTSW 14 63141856 missense probably damaging 1.00
R7422:Ctsb UTSW 14 63142303 missense probably benign 0.00
R7472:Ctsb UTSW 14 63138101 missense probably benign 0.04
R7573:Ctsb UTSW 14 63138101 missense probably benign 0.04
R7721:Ctsb UTSW 14 63133316 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AGGACAGTATATTCCCAGGGGAC -3'
(R):5'- TAATGTCAGCTTGCAACCCC -3'

Sequencing Primer
(F):5'- GGACCTTGGCATTTGTACCG -3'
(R):5'- AGACCATGTCTACATCCTGTGGG -3'
Posted On2018-05-04