Incidental Mutation 'R6396:Dyrk1a'
ID516019
Institutional Source Beutler Lab
Gene Symbol Dyrk1a
Ensembl Gene ENSMUSG00000022897
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a
SynonymsD16Ertd493e, Mnbh, 2310043O08Rik, D16Ertd272e, Dyrk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location94570010-94695517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94671440 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 230 (Q230K)
Ref Sequence ENSEMBL: ENSMUSP00000112853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023614] [ENSMUST00000119878] [ENSMUST00000122284] [ENSMUST00000155791]
Predicted Effect probably damaging
Transcript: ENSMUST00000023614
AA Change: Q268K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023614
Gene: ENSMUSG00000022897
AA Change: Q268K

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119878
AA Change: Q268K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113660
Gene: ENSMUSG00000022897
AA Change: Q268K

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122284
AA Change: Q230K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112853
Gene: ENSMUSG00000022897
AA Change: Q230K

DomainStartEndE-ValueType
low complexity region 127 138 N/A INTRINSIC
S_TKc 150 470 6.63e-79 SMART
low complexity region 493 516 N/A INTRINSIC
low complexity region 590 611 N/A INTRINSIC
low complexity region 641 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134383
Predicted Effect probably benign
Transcript: ENSMUST00000155791
SMART Domains Protein: ENSMUSP00000119669
Gene: ENSMUSG00000022897

DomainStartEndE-ValueType
PDB:3ANR|D 126 181 6e-21 PDB
SCOP:d1howa_ 147 179 4e-7 SMART
Blast:S_TKc 159 181 5e-6 BLAST
Meta Mutation Damage Score 0.9276 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted deletion present a general embryonic growth delay and die during midgestation. Heterozygotes display reduced postnatal survival, postnatal growth retardation, microcephaly, behavioral and motor deficits, and altered neocortical pyramidal cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Dyrk1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Dyrk1a APN 16 94685084 missense probably benign 0.21
IGL01599:Dyrk1a APN 16 94691884 missense possibly damaging 0.94
IGL01809:Dyrk1a APN 16 94659617 missense probably benign 0.00
IGL02201:Dyrk1a APN 16 94692149 missense probably benign 0.05
IGL02345:Dyrk1a APN 16 94671362 missense possibly damaging 0.88
IGL02508:Dyrk1a APN 16 94685183 missense probably damaging 0.97
IGL02709:Dyrk1a APN 16 94685243 missense probably benign 0.08
IGL02713:Dyrk1a APN 16 94685345 splice site probably benign
R0414:Dyrk1a UTSW 16 94663842 missense probably damaging 1.00
R2107:Dyrk1a UTSW 16 94686527 missense probably damaging 1.00
R2394:Dyrk1a UTSW 16 94685132 missense probably benign 0.02
R3124:Dyrk1a UTSW 16 94668801 splice site probably benign
R3125:Dyrk1a UTSW 16 94668801 splice site probably benign
R3792:Dyrk1a UTSW 16 94685074 missense probably benign 0.31
R3963:Dyrk1a UTSW 16 94663746 missense probably benign 0.00
R4573:Dyrk1a UTSW 16 94692023 missense possibly damaging 0.90
R4652:Dyrk1a UTSW 16 94692065 missense probably benign 0.02
R4965:Dyrk1a UTSW 16 94691995 nonsense probably null
R5326:Dyrk1a UTSW 16 94686581 missense probably damaging 0.98
R5540:Dyrk1a UTSW 16 94685343 critical splice donor site probably null
R5593:Dyrk1a UTSW 16 94659583 missense possibly damaging 0.64
R6313:Dyrk1a UTSW 16 94659514 missense probably damaging 0.99
R6524:Dyrk1a UTSW 16 94685120 missense probably benign 0.02
R7036:Dyrk1a UTSW 16 94686568 missense probably benign 0.09
R7326:Dyrk1a UTSW 16 94692043 missense probably damaging 0.97
R7861:Dyrk1a UTSW 16 94691716 nonsense probably null
R7944:Dyrk1a UTSW 16 94691716 nonsense probably null
RF010:Dyrk1a UTSW 16 94677563 missense probably benign
Z1176:Dyrk1a UTSW 16 94691762 missense probably benign 0.06
Z1177:Dyrk1a UTSW 16 94691580 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCGTGTGTAACTTAGGTG -3'
(R):5'- ACCTGTCCAAGATGAACAGC -3'

Sequencing Primer
(F):5'- CGTGTGTAACTTAGGTGAAATTTTC -3'
(R):5'- CTATGGTAAGTCACAAGTCCTAAAGG -3'
Posted On2018-05-04