Mutagenetix > Incidental Mutation

Incidental Mutation 'R6396:Igf2r'

516020

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR

MMRRC Submission

044544-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.905) question?

Stock #

R6396 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12901293-12988551 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12932977 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 848 (I848M)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably benign
Transcript: ENSMUST00000024599
AA Change: I848M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: I848M

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 97.9%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap35	A	T	7: 16,296,224 (GRCm39)	I947K	probably damaging	Het
B3galnt2	A	T	13: 14,170,333 (GRCm39)	I447F	probably damaging	Het
Cacna2d3	C	A	14: 29,118,522 (GRCm39)	V134L	probably benign	Het
Clcn4	C	T	7: 7,297,024 (GRCm39)	G145S	probably damaging	Het
Cndp1	A	T	18: 84,650,135 (GRCm39)	M186K	probably benign	Het
Cntn6	A	G	6: 104,627,461 (GRCm39)	Y98C	probably damaging	Het
Ctsb	T	C	14: 63,375,550 (GRCm39)	V172A	probably benign	Het
Dnase1l1	C	T	X: 73,320,644 (GRCm39)		probably null	Homo
Dyrk1a	C	A	16: 94,472,299 (GRCm39)	Q230K	probably damaging	Het
Ech1	C	T	7: 28,529,763 (GRCm39)		probably null	Het
Fam81b	T	A	13: 76,399,968 (GRCm39)	R97W	probably damaging	Het
Heatr1	A	G	13: 12,420,978 (GRCm39)	E423G	possibly damaging	Het
Hydin	A	T	8: 111,233,521 (GRCm39)	K1786N	probably damaging	Het
Igkv10-96	G	A	6: 68,608,969 (GRCm39)	Q109*	probably null	Het
Mup6	T	C	4: 60,004,837 (GRCm39)	I76T	possibly damaging	Het
Nmt2	A	G	2: 3,315,738 (GRCm39)	R243G	probably benign	Het
Nsd1	G	A	13: 55,386,602 (GRCm39)	G119D	probably damaging	Het
Or1ad8	A	G	11: 50,898,312 (GRCm39)	H171R	possibly damaging	Het
Or4c113	A	G	2: 88,885,641 (GRCm39)	I43T	probably benign	Het
Or4c120	T	G	2: 89,001,034 (GRCm39)	D174A	probably damaging	Het
Or51ab3	C	T	7: 103,201,888 (GRCm39)	Q299*	probably null	Het
Otx1	C	A	11: 21,947,037 (GRCm39)	A91S	probably damaging	Het
Pank3	T	C	11: 35,669,516 (GRCm39)	V250A	probably damaging	Het
Pcdh10	A	G	3: 45,334,495 (GRCm39)	I270V	possibly damaging	Het
Pnp2	T	A	14: 51,200,616 (GRCm39)	V94E	probably damaging	Het
Prdm10	T	C	9: 31,229,842 (GRCm39)	V86A	possibly damaging	Het
Resf1	A	G	6: 149,229,417 (GRCm39)	D821G	probably damaging	Het
Riox1	G	A	12: 83,998,087 (GRCm39)	D208N	possibly damaging	Het
Rrp15	A	G	1: 186,469,783 (GRCm39)		probably null	Het
Skor1	G	T	9: 63,052,232 (GRCm39)	P579Q	probably damaging	Het
Slc44a4	T	A	17: 35,147,860 (GRCm39)	Y481*	probably null	Het
Smg7	A	T	1: 152,724,351 (GRCm39)	V610E	probably benign	Het
Tlx1	A	G	19: 45,144,491 (GRCm39)	Q71R	probably damaging	Het
Vmn2r27	A	T	6: 124,201,125 (GRCm39)	Y277*	probably null	Het
Zswim2	T	A	2: 83,754,062 (GRCm39)	R199S	probably damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,932,877 (GRCm39)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,958,215 (GRCm39)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,919,245 (GRCm39)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,902,754 (GRCm39)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,923,662 (GRCm39)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,914,261 (GRCm39)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,923,236 (GRCm39)	missense	probably benign
IGL01557:Igf2r	APN	17	12,923,522 (GRCm39)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,902,872 (GRCm39)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,944,302 (GRCm39)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,920,200 (GRCm39)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,902,709 (GRCm39)	missense	probably benign
IGL01839:Igf2r	APN	17	12,923,909 (GRCm39)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,933,798 (GRCm39)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,923,225 (GRCm39)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,912,079 (GRCm39)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,920,892 (GRCm39)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,917,403 (GRCm39)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,967,650 (GRCm39)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,930,974 (GRCm39)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,938,770 (GRCm39)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,911,610 (GRCm39)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,913,007 (GRCm39)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,929,633 (GRCm39)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,945,563 (GRCm39)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,935,559 (GRCm39)	missense	probably damaging	1.00
blunt	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
brusque	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
gruff	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
outlier	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,910,849 (GRCm39)	missense	probably benign
R0165:Igf2r	UTSW	17	12,917,414 (GRCm39)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,902,835 (GRCm39)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,910,951 (GRCm39)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,936,161 (GRCm39)	splice site	probably null
R0722:Igf2r	UTSW	17	12,934,382 (GRCm39)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,910,988 (GRCm39)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,913,011 (GRCm39)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,936,156 (GRCm39)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,910,172 (GRCm39)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,945,196 (GRCm39)	missense	probably benign
R1693:Igf2r	UTSW	17	12,923,203 (GRCm39)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,916,328 (GRCm39)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,923,157 (GRCm39)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,952,790 (GRCm39)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,911,625 (GRCm39)	missense	probably benign
R2060:Igf2r	UTSW	17	12,920,206 (GRCm39)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,917,138 (GRCm39)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,941,095 (GRCm39)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,934,830 (GRCm39)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,941,198 (GRCm39)	splice site	probably null
R2696:Igf2r	UTSW	17	12,914,231 (GRCm39)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,928,355 (GRCm39)	missense	probably benign
R3930:Igf2r	UTSW	17	12,924,716 (GRCm39)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,967,638 (GRCm39)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,921,141 (GRCm39)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,922,352 (GRCm39)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,903,013 (GRCm39)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,920,240 (GRCm39)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,910,764 (GRCm39)	splice site	probably null
R4980:Igf2r	UTSW	17	12,922,247 (GRCm39)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,944,303 (GRCm39)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,912,032 (GRCm39)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,958,221 (GRCm39)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,936,254 (GRCm39)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,917,239 (GRCm39)	splice site	probably null
R5794:Igf2r	UTSW	17	12,928,332 (GRCm39)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,933,000 (GRCm39)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,902,787 (GRCm39)	missense	probably benign
R6584:Igf2r	UTSW	17	12,920,137 (GRCm39)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,917,505 (GRCm39)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,933,831 (GRCm39)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,932,969 (GRCm39)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,922,263 (GRCm39)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,916,228 (GRCm39)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,937,605 (GRCm39)	missense	probably benign
R7030:Igf2r	UTSW	17	12,952,753 (GRCm39)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,917,212 (GRCm39)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,923,210 (GRCm39)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,933,003 (GRCm39)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,922,371 (GRCm39)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,917,115 (GRCm39)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,929,532 (GRCm39)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,917,160 (GRCm39)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,954,878 (GRCm39)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,958,256 (GRCm39)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,967,591 (GRCm39)	missense	probably benign
R8022:Igf2r	UTSW	17	12,937,682 (GRCm39)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,920,125 (GRCm39)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,910,958 (GRCm39)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,952,747 (GRCm39)	missense	probably benign
R8359:Igf2r	UTSW	17	12,902,748 (GRCm39)	missense	probably benign
R8500:Igf2r	UTSW	17	12,928,328 (GRCm39)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,923,200 (GRCm39)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,923,524 (GRCm39)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,920,131 (GRCm39)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,945,659 (GRCm39)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,935,537 (GRCm39)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,970,180 (GRCm39)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,910,100 (GRCm39)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,958,238 (GRCm39)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,914,240 (GRCm39)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,924,646 (GRCm39)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,917,215 (GRCm39)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,905,641 (GRCm39)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,913,027 (GRCm39)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,945,588 (GRCm39)	missense	probably benign
X0028:Igf2r	UTSW	17	12,923,800 (GRCm39)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,916,286 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCCTGGTGCTTTTCTGAAG -3'
(R):5'- CTATCACAACAGCAGCTTCGG -3'

Sequencing Primer
(F):5'- GGTGCTTTTCTGAAGTCCTTGCC -3'
(R):5'- AACAGCAGCTTCGGGGTTC -3'

Posted On

2018-05-04