Incidental Mutation 'R6396:Slc44a4'
ID516021
Institutional Source Beutler Lab
Gene Symbol Slc44a4
Ensembl Gene ENSMUSG00000007034
Gene Namesolute carrier family 44, member 4
Synonyms2210409B01Rik, NG22
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34914466-34930436 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34928884 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 481 (Y481*)
Ref Sequence ENSEMBL: ENSMUSP00000132965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000007253] [ENSMUST00000169230]
Predicted Effect probably null
Transcript: ENSMUST00000007249
AA Change: Y633*
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034
AA Change: Y633*

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000007253
SMART Domains Protein: ENSMUSP00000007253
Gene: ENSMUSG00000007038

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:BNR_3 74 249 1e-16 PFAM
Pfam:BNR_2 82 377 1.8e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169230
AA Change: Y481*
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034
AA Change: Y481*

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174715
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be a sodium-dependent transmembrane transport protein involved in the uptake of choline by cholinergic neurons. Defects in this gene can cause sialidosis, a lysosomal storage disease. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Slc44a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Slc44a4 APN 17 34930240 utr 3 prime probably benign
IGL01097:Slc44a4 APN 17 34921569 missense probably damaging 0.97
IGL01296:Slc44a4 APN 17 34921698 missense probably benign 0.39
IGL01606:Slc44a4 APN 17 34929018 missense probably damaging 1.00
IGL01759:Slc44a4 APN 17 34921243 missense probably benign 0.00
IGL02026:Slc44a4 APN 17 34921856 splice site probably benign
IGL02119:Slc44a4 APN 17 34928661 missense probably damaging 1.00
IGL02338:Slc44a4 APN 17 34923810 missense possibly damaging 0.90
IGL02383:Slc44a4 APN 17 34927710 missense probably benign 0.00
IGL02526:Slc44a4 APN 17 34928487 missense probably damaging 0.99
IGL02744:Slc44a4 APN 17 34927800 missense probably damaging 1.00
IGL02754:Slc44a4 APN 17 34921303 missense probably damaging 0.98
ANU74:Slc44a4 UTSW 17 34921578 missense probably damaging 1.00
PIT4142001:Slc44a4 UTSW 17 34921275 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0452:Slc44a4 UTSW 17 34928095 missense possibly damaging 0.82
R0894:Slc44a4 UTSW 17 34928490 missense possibly damaging 0.92
R1136:Slc44a4 UTSW 17 34928022 missense probably damaging 1.00
R1224:Slc44a4 UTSW 17 34921868 missense probably benign 0.18
R1779:Slc44a4 UTSW 17 34921925 missense probably damaging 1.00
R2679:Slc44a4 UTSW 17 34923423 splice site probably benign
R3499:Slc44a4 UTSW 17 34921680 missense probably benign 0.02
R3732:Slc44a4 UTSW 17 34921561 synonymous silent
R4084:Slc44a4 UTSW 17 34917347 missense probably damaging 1.00
R4197:Slc44a4 UTSW 17 34918252 missense probably benign 0.12
R4536:Slc44a4 UTSW 17 34923839 missense probably damaging 1.00
R4547:Slc44a4 UTSW 17 34927755 missense probably damaging 1.00
R5093:Slc44a4 UTSW 17 34921243 missense probably benign 0.00
R6005:Slc44a4 UTSW 17 34923454 missense possibly damaging 0.69
R6660:Slc44a4 UTSW 17 34930225 missense probably damaging 0.99
R6860:Slc44a4 UTSW 17 34921068 missense probably damaging 1.00
R6863:Slc44a4 UTSW 17 34923822 missense probably benign 0.41
R6947:Slc44a4 UTSW 17 34928068 missense probably null 1.00
R7250:Slc44a4 UTSW 17 34918544 critical splice donor site probably null
R7297:Slc44a4 UTSW 17 34927912 missense probably damaging 0.98
R7425:Slc44a4 UTSW 17 34921691 missense possibly damaging 0.94
R7696:Slc44a4 UTSW 17 34928700 missense probably damaging 1.00
R7871:Slc44a4 UTSW 17 34923852 critical splice donor site probably null
R7954:Slc44a4 UTSW 17 34923852 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCAAGACCAGGGTTTACGG -3'
(R):5'- TGGAGGCCTAAGAGCTTGAG -3'

Sequencing Primer
(F):5'- ACCAGGGTTTACGGGGTCAG -3'
(R):5'- GGCACTCACGGAAGCAG -3'
Posted On2018-05-04