Incidental Mutation 'R6396:Cndp1'
ID516022
Institutional Source Beutler Lab
Gene Symbol Cndp1
Ensembl Gene ENSMUSG00000056162
Gene Namecarnosine dipeptidase 1 (metallopeptidase M20 family)
SynonymsCn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location84610509-84650084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84632010 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 186 (M186K)
Ref Sequence ENSEMBL: ENSMUSP00000069699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070139]
Predicted Effect probably benign
Transcript: ENSMUST00000070139
AA Change: M186K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069699
Gene: ENSMUSG00000056162
AA Change: M186K

DomainStartEndE-ValueType
Pfam:Peptidase_M20 103 477 4.3e-33 PFAM
Pfam:M20_dimer 216 377 3.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145981
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Cndp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Cndp1 APN 18 84611665 missense probably benign 0.05
IGL01326:Cndp1 APN 18 84622232 missense probably benign 0.01
IGL01762:Cndp1 APN 18 84622286 missense probably damaging 1.00
IGL02061:Cndp1 APN 18 84634626 missense probably damaging 1.00
IGL02731:Cndp1 APN 18 84631958 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0285:Cndp1 UTSW 18 84618238 missense possibly damaging 0.72
R0494:Cndp1 UTSW 18 84619533 missense probably benign 0.01
R0967:Cndp1 UTSW 18 84634652 splice site probably benign
R0968:Cndp1 UTSW 18 84634652 splice site probably benign
R0969:Cndp1 UTSW 18 84634652 splice site probably benign
R1069:Cndp1 UTSW 18 84634652 splice site probably benign
R1170:Cndp1 UTSW 18 84611625 missense probably benign 0.00
R1340:Cndp1 UTSW 18 84634652 splice site probably benign
R1414:Cndp1 UTSW 18 84634652 splice site probably benign
R1432:Cndp1 UTSW 18 84634652 splice site probably benign
R1891:Cndp1 UTSW 18 84619633 missense probably null 1.00
R3912:Cndp1 UTSW 18 84631999 missense probably benign 0.00
R4024:Cndp1 UTSW 18 84628813 missense probably damaging 1.00
R4238:Cndp1 UTSW 18 84618217 missense probably benign
R4564:Cndp1 UTSW 18 84622286 missense probably damaging 1.00
R4989:Cndp1 UTSW 18 84631900 missense probably damaging 0.99
R5015:Cndp1 UTSW 18 84631911 missense probably damaging 1.00
R5108:Cndp1 UTSW 18 84632061 missense probably damaging 1.00
R5502:Cndp1 UTSW 18 84632013 missense possibly damaging 0.56
R5835:Cndp1 UTSW 18 84612833 missense probably benign 0.00
R6549:Cndp1 UTSW 18 84636184 missense probably benign 0.04
R7251:Cndp1 UTSW 18 84622197 missense probably benign
R7465:Cndp1 UTSW 18 84619541 missense probably damaging 1.00
R7638:Cndp1 UTSW 18 84636049 missense probably benign 0.36
R7812:Cndp1 UTSW 18 84637869 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGGGAGAATGTCCTGAC -3'
(R):5'- TACGCAATCCACACGTTGAG -3'

Sequencing Primer
(F):5'- CCAAGGGAGAATGTCCTGACTTTTTC -3'
(R):5'- CACACGTTGAGTATGGATGATTAC -3'
Posted On2018-05-04