Incidental Mutation 'R6396:Tlx1'
ID516023
Institutional Source Beutler Lab
Gene Symbol Tlx1
Ensembl Gene ENSMUSG00000025215
Gene NameT cell leukemia, homeobox 1
SynonymsHox11, Hox-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location45150680-45156943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45156052 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 71 (Q71R)
Ref Sequence ENSEMBL: ENSMUSP00000133627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026236] [ENSMUST00000174617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026236
AA Change: Q313R

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026236
Gene: ENSMUSG00000025215
AA Change: Q313R

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 52 92 N/A INTRINSIC
low complexity region 107 133 N/A INTRINSIC
HOX 204 266 1.81e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173437
Predicted Effect probably damaging
Transcript: ENSMUST00000174617
AA Change: Q71R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133627
Gene: ENSMUSG00000025215
AA Change: Q71R

DomainStartEndE-ValueType
Pfam:Homeobox 1 19 6.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear transcription factor that belongs to the NK-linked or NK-like (NKL) subfamily of homeobox genes. The encoded protein is required for normal development of the spleen during embryogenesis. This protein is also involved in specification of neuronal cell fates. Ectopic expression of this gene due to chromosomal translocations is associated with certain T-cell acute lymphoblastic leukemias. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous mutant embryos show cellular disorganization at the site of splenic development and never develop a spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr1225 T G 2: 89,170,690 D174A probably damaging Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Tlx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
vent UTSW 19 45156021 missense probably damaging 1.00
R1703:Tlx1 UTSW 19 45156004 missense possibly damaging 0.95
R4889:Tlx1 UTSW 19 45150979 missense probably damaging 1.00
R4985:Tlx1 UTSW 19 45150982 missense possibly damaging 0.94
R5078:Tlx1 UTSW 19 45156021 missense probably damaging 1.00
R6025:Tlx1 UTSW 19 45155974 missense probably damaging 0.99
R6891:Tlx1 UTSW 19 45151318 missense probably damaging 1.00
R7163:Tlx1 UTSW 19 45151216 missense probably damaging 0.99
R7856:Tlx1 UTSW 19 45155988 nonsense probably null
R7939:Tlx1 UTSW 19 45155988 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCCTGGCTAGTAATTGCTTG -3'
(R):5'- TCCACCGAAGACAGGAAGTG -3'

Sequencing Primer
(F):5'- AGTAATTGCTTGTTCCCCACG -3'
(R):5'- AGTGGAGGCGGTGCTTG -3'
Posted On2018-05-04