Incidental Mutation 'R6397:Map4'
ID516037
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6397 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110027716 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 151 (D151E)
Ref Sequence ENSEMBL: ENSMUSP00000132662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000165876]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035055
AA Change: D151E

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: D151E

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165876
AA Change: D151E

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: D151E

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196729
Meta Mutation Damage Score 0.1806 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 94% (29/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,066,245 N528D probably benign Het
Arfgef3 G T 10: 18,607,665 S1437* probably null Het
Cdh1 T C 8: 106,604,290 S18P possibly damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Dmbt1 T C 7: 131,103,578 V1137A possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam69a T A 5: 107,911,638 K105* probably null Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Ifi203 C A 1: 173,927,204 V654L probably benign Het
Kalrn A G 16: 33,992,985 L787P probably damaging Het
Kazald1 A G 19: 45,076,878 E66G probably benign Het
Msrb3 G A 10: 120,791,451 T42I probably damaging Het
Nfatc1 C T 18: 80,635,941 C744Y probably damaging Het
Nlgn1 T A 3: 25,433,663 H836L possibly damaging Het
Nrxn2 A G 19: 6,532,122 N653D probably damaging Het
Olfr324 A G 11: 58,597,512 T39A probably benign Het
Oprk1 A G 1: 5,598,748 Y139C probably damaging Het
Pcdhb5 T A 18: 37,321,505 S313T probably benign Het
Pcdhb8 C T 18: 37,355,463 R65* probably null Het
Pstpip2 T G 18: 77,873,379 C221G probably benign Het
Sall2 T A 14: 52,315,153 H195L probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sptbn2 A T 19: 4,742,418 E1367V possibly damaging Het
Stau1 A G 2: 166,951,007 V346A possibly damaging Het
Tchh A G 3: 93,445,866 E871G unknown Het
Tlr9 A G 9: 106,225,106 N532S probably damaging Het
Tuba1c G A 15: 99,037,857 A400T probably benign Het
Vmn2r86 A T 10: 130,446,262 Y828* probably null Het
Vps45 A G 3: 96,042,852 I255T probably benign Het
Yap1 T C 9: 8,001,466 Y173C probably damaging Het
Zc3h7b A T 15: 81,792,854 I821F probably benign Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7690:Map4 UTSW 9 109999793 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGCTTCATCATATGTAGTCATGTT -3'
(R):5'- TAGGTCCATGAGTACCTGCC -3'

Sequencing Primer
(F):5'- CTTCCTAATTGTATTCACTGTGT -3'
(R):5'- TGAACTCTGGACCTTCGGAAG -3'
Posted On2018-05-04