Incidental Mutation 'R6397:Vmn2r86'
ID516040
Institutional Source Beutler Lab
Gene Symbol Vmn2r86
Ensembl Gene ENSMUSG00000092162
Gene Namevomeronasal 2, receptor 86
SynonymsEG625109
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6397 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130445707-130455894 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 130446262 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 828 (Y828*)
Ref Sequence ENSEMBL: ENSMUSP00000126596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170257]
Predicted Effect probably null
Transcript: ENSMUST00000170257
AA Change: Y828*
SMART Domains Protein: ENSMUSP00000126596
Gene: ENSMUSG00000092162
AA Change: Y828*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 1.1e-25 PFAM
Pfam:NCD3G 508 562 2.4e-19 PFAM
Pfam:7tm_3 595 829 6.4e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 94% (29/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,066,245 N528D probably benign Het
Arfgef3 G T 10: 18,607,665 S1437* probably null Het
Cdh1 T C 8: 106,604,290 S18P possibly damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Dmbt1 T C 7: 131,103,578 V1137A possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam69a T A 5: 107,911,638 K105* probably null Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Ifi203 C A 1: 173,927,204 V654L probably benign Het
Kalrn A G 16: 33,992,985 L787P probably damaging Het
Kazald1 A G 19: 45,076,878 E66G probably benign Het
Map4 T A 9: 110,027,716 D151E possibly damaging Het
Msrb3 G A 10: 120,791,451 T42I probably damaging Het
Nfatc1 C T 18: 80,635,941 C744Y probably damaging Het
Nlgn1 T A 3: 25,433,663 H836L possibly damaging Het
Nrxn2 A G 19: 6,532,122 N653D probably damaging Het
Olfr324 A G 11: 58,597,512 T39A probably benign Het
Oprk1 A G 1: 5,598,748 Y139C probably damaging Het
Pcdhb5 T A 18: 37,321,505 S313T probably benign Het
Pcdhb8 C T 18: 37,355,463 R65* probably null Het
Pstpip2 T G 18: 77,873,379 C221G probably benign Het
Sall2 T A 14: 52,315,153 H195L probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sptbn2 A T 19: 4,742,418 E1367V possibly damaging Het
Stau1 A G 2: 166,951,007 V346A possibly damaging Het
Tchh A G 3: 93,445,866 E871G unknown Het
Tlr9 A G 9: 106,225,106 N532S probably damaging Het
Tuba1c G A 15: 99,037,857 A400T probably benign Het
Vps45 A G 3: 96,042,852 I255T probably benign Het
Yap1 T C 9: 8,001,466 Y173C probably damaging Het
Zc3h7b A T 15: 81,792,854 I821F probably benign Het
Other mutations in Vmn2r86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Vmn2r86 APN 10 130453026 missense probably damaging 0.99
IGL01328:Vmn2r86 APN 10 130452496 missense possibly damaging 0.78
IGL01377:Vmn2r86 APN 10 130452986 missense probably damaging 0.99
IGL01548:Vmn2r86 APN 10 130446282 missense probably benign 0.22
IGL01804:Vmn2r86 APN 10 130452989 missense probably damaging 0.99
IGL01921:Vmn2r86 APN 10 130455741 missense probably benign 0.00
IGL02406:Vmn2r86 APN 10 130448639 missense possibly damaging 0.81
IGL02625:Vmn2r86 APN 10 130452912 missense probably damaging 1.00
IGL02960:Vmn2r86 APN 10 130453767 missense possibly damaging 0.74
IGL03104:Vmn2r86 APN 10 130446632 missense probably damaging 1.00
R0408:Vmn2r86 UTSW 10 130446854 missense probably damaging 1.00
R0437:Vmn2r86 UTSW 10 130446543 missense probably damaging 1.00
R0577:Vmn2r86 UTSW 10 130452575 missense probably benign 0.04
R0726:Vmn2r86 UTSW 10 130446396 missense probably damaging 1.00
R0811:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R0812:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R1055:Vmn2r86 UTSW 10 130446357 missense probably damaging 1.00
R1066:Vmn2r86 UTSW 10 130446276 missense probably benign 0.01
R1199:Vmn2r86 UTSW 10 130448574 splice site probably benign
R1332:Vmn2r86 UTSW 10 130446870 missense probably damaging 1.00
R1568:Vmn2r86 UTSW 10 130453141 missense probably benign 0.09
R1866:Vmn2r86 UTSW 10 130446386 missense probably damaging 1.00
R1897:Vmn2r86 UTSW 10 130452445 missense probably damaging 1.00
R2017:Vmn2r86 UTSW 10 130446713 missense probably benign 0.39
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3858:Vmn2r86 UTSW 10 130455725 missense probably benign
R4049:Vmn2r86 UTSW 10 130447097 missense probably damaging 0.98
R4378:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4411:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4413:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4422:Vmn2r86 UTSW 10 130452976 missense possibly damaging 0.87
R4738:Vmn2r86 UTSW 10 130447070 missense probably damaging 0.99
R4767:Vmn2r86 UTSW 10 130455737 missense probably benign 0.00
R4872:Vmn2r86 UTSW 10 130453591 missense probably damaging 0.98
R4880:Vmn2r86 UTSW 10 130453615 missense probably benign 0.33
R5092:Vmn2r86 UTSW 10 130446587 missense probably damaging 1.00
R5421:Vmn2r86 UTSW 10 130446936 missense probably benign 0.41
R6007:Vmn2r86 UTSW 10 130453666 missense probably damaging 1.00
R6330:Vmn2r86 UTSW 10 130446527 missense probably benign 0.05
R6355:Vmn2r86 UTSW 10 130455894 start codon destroyed probably damaging 0.98
R6419:Vmn2r86 UTSW 10 130446926 missense probably damaging 1.00
R6933:Vmn2r86 UTSW 10 130446257 missense probably damaging 1.00
R6937:Vmn2r86 UTSW 10 130448654 missense probably damaging 1.00
R6959:Vmn2r86 UTSW 10 130446531 missense probably damaging 1.00
R7010:Vmn2r86 UTSW 10 130455857 missense probably benign
R7549:Vmn2r86 UTSW 10 130446828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCTGTCCTGTTTGTAAGTTC -3'
(R):5'- GAGCTTCATTGTGGCTTTCC -3'

Sequencing Primer
(F):5'- CTGTCCTGTTTGTAAGTTCAAATTTG -3'
(R):5'- GGAACCTTCCTGACAGATTCAATG -3'
Posted On2018-05-04