Mutagenetix > Incidental Mutation

Incidental Mutation 'R6397:Sall2'

516042

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6397 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52315153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 195 (H195L)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: H195L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: H195L

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: H193L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Meta Mutation Damage Score

0.5055

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.5%

Validation Efficiency

94% (29/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,066,245	N528D	probably benign	Het
Arfgef3	G	T	10: 18,607,665	S1437*	probably null	Het
Cdh1	T	C	8: 106,604,290	S18P	possibly damaging	Het
Cyhr1	A	T	15: 76,648,191	I239N	probably damaging	Het
Dmbt1	T	C	7: 131,103,578	V1137A	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Fam69a	T	A	5: 107,911,638	K105*	probably null	Het
Gm3486	G	A	14: 41,486,386	L123F	probably benign	Het
Ifi203	C	A	1: 173,927,204	V654L	probably benign	Het
Kalrn	A	G	16: 33,992,985	L787P	probably damaging	Het
Kazald1	A	G	19: 45,076,878	E66G	probably benign	Het
Map4	T	A	9: 110,027,716	D151E	possibly damaging	Het
Msrb3	G	A	10: 120,791,451	T42I	probably damaging	Het
Nfatc1	C	T	18: 80,635,941	C744Y	probably damaging	Het
Nlgn1	T	A	3: 25,433,663	H836L	possibly damaging	Het
Nrxn2	A	G	19: 6,532,122	N653D	probably damaging	Het
Olfr324	A	G	11: 58,597,512	T39A	probably benign	Het
Oprk1	A	G	1: 5,598,748	Y139C	probably damaging	Het
Pcdhb5	T	A	18: 37,321,505	S313T	probably benign	Het
Pcdhb8	C	T	18: 37,355,463	R65*	probably null	Het
Pstpip2	T	G	18: 77,873,379	C221G	probably benign	Het
Snx7	A	G	3: 117,846,623	I79T	probably benign	Het
Sptbn2	A	T	19: 4,742,418	E1367V	possibly damaging	Het
Stau1	A	G	2: 166,951,007	V346A	possibly damaging	Het
Tchh	A	G	3: 93,445,866	E871G	unknown	Het
Tlr9	A	G	9: 106,225,106	N532S	probably damaging	Het
Tuba1c	G	A	15: 99,037,857	A400T	probably benign	Het
Vmn2r86	A	T	10: 130,446,262	Y828*	probably null	Het
Vps45	A	G	3: 96,042,852	I255T	probably benign	Het
Yap1	T	C	9: 8,001,466	Y173C	probably damaging	Het
Zc3h7b	A	T	15: 81,792,854	I821F	probably benign	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- CCAGTGTCTTGCCAGTTTGC -3'
(R):5'- ATCTTCTGGGCAATTCCTGGTC -3'

Sequencing Primer
(F):5'- CGCTGGCTTGATGGGAC -3'
(R):5'- ATTCCTGGTCGCTGCCACAG -3'

Posted On

2018-05-04