Incidental Mutation 'R6397:Cyhr1'
ID516043
Institutional Source Beutler Lab
Gene Symbol Cyhr1
Ensembl Gene ENSMUSG00000053929
Gene Namecysteine and histidine rich 1
Synonyms1110031M01Rik, Chrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R6397 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76643395-76660117 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76648191 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 239 (I239N)
Ref Sequence ENSEMBL: ENSMUSP00000155816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081291] [ENSMUST00000176274] [ENSMUST00000229524]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081291
AA Change: I151N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929
AA Change: I151N

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176274
AA Change: I239N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134739
Gene: ENSMUSG00000053929
AA Change: I239N

DomainStartEndE-ValueType
low complexity region 3 48 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
RING 106 150 1.9e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229524
AA Change: I239N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229552
Meta Mutation Damage Score 0.2000 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 94% (29/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,066,245 N528D probably benign Het
Arfgef3 G T 10: 18,607,665 S1437* probably null Het
Cdh1 T C 8: 106,604,290 S18P possibly damaging Het
Dmbt1 T C 7: 131,103,578 V1137A possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam69a T A 5: 107,911,638 K105* probably null Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Ifi203 C A 1: 173,927,204 V654L probably benign Het
Kalrn A G 16: 33,992,985 L787P probably damaging Het
Kazald1 A G 19: 45,076,878 E66G probably benign Het
Map4 T A 9: 110,027,716 D151E possibly damaging Het
Msrb3 G A 10: 120,791,451 T42I probably damaging Het
Nfatc1 C T 18: 80,635,941 C744Y probably damaging Het
Nlgn1 T A 3: 25,433,663 H836L possibly damaging Het
Nrxn2 A G 19: 6,532,122 N653D probably damaging Het
Olfr324 A G 11: 58,597,512 T39A probably benign Het
Oprk1 A G 1: 5,598,748 Y139C probably damaging Het
Pcdhb5 T A 18: 37,321,505 S313T probably benign Het
Pcdhb8 C T 18: 37,355,463 R65* probably null Het
Pstpip2 T G 18: 77,873,379 C221G probably benign Het
Sall2 T A 14: 52,315,153 H195L probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sptbn2 A T 19: 4,742,418 E1367V possibly damaging Het
Stau1 A G 2: 166,951,007 V346A possibly damaging Het
Tchh A G 3: 93,445,866 E871G unknown Het
Tlr9 A G 9: 106,225,106 N532S probably damaging Het
Tuba1c G A 15: 99,037,857 A400T probably benign Het
Vmn2r86 A T 10: 130,446,262 Y828* probably null Het
Vps45 A G 3: 96,042,852 I255T probably benign Het
Yap1 T C 9: 8,001,466 Y173C probably damaging Het
Zc3h7b A T 15: 81,792,854 I821F probably benign Het
Other mutations in Cyhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cyhr1 APN 15 76646538 missense probably damaging 1.00
IGL03163:Cyhr1 APN 15 76659274 missense probably damaging 0.97
R0107:Cyhr1 UTSW 15 76646347 missense possibly damaging 0.90
R0445:Cyhr1 UTSW 15 76648257 missense probably damaging 1.00
R0759:Cyhr1 UTSW 15 76646185 makesense probably null
R1327:Cyhr1 UTSW 15 76649176 missense probably damaging 0.98
R1366:Cyhr1 UTSW 15 76648969 missense probably damaging 0.96
R1950:Cyhr1 UTSW 15 76659217 critical splice donor site probably null
R3416:Cyhr1 UTSW 15 76658715 splice site probably null
R5092:Cyhr1 UTSW 15 76646312 missense probably benign 0.11
R5749:Cyhr1 UTSW 15 76658644 splice site probably null
R5860:Cyhr1 UTSW 15 76648191 missense probably damaging 1.00
R5860:Cyhr1 UTSW 15 76656415 missense probably damaging 1.00
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6481:Cyhr1 UTSW 15 76658708 splice site probably null
R6533:Cyhr1 UTSW 15 76647730 nonsense probably null
R7466:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7484:Cyhr1 UTSW 15 76646235 missense probably damaging 1.00
R7629:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7732:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7763:Cyhr1 UTSW 15 76658547 missense probably damaging 0.99
R7861:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGGAGCCATGCAGGTACATC -3'
(R):5'- ACCGTTTGTTCCAGCCACAG -3'

Sequencing Primer
(F):5'- ACTGCCCAGAGCCTACTG -3'
(R):5'- GTTCCAGCCACAGAGTTGATC -3'
Posted On2018-05-04