Mutagenetix > Incidental Mutations

Incidental Mutation 'R6398:Zbbx'

516060

Institutional Source

Beutler Lab

Gene Symbol

Zbbx

Ensembl Gene

ENSMUSG00000034151

Gene Name

zinc finger, B-box domain containing

Synonyms

MMRRC Submission

044381-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R6398 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75037907-75165034 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 75078565 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 388 (N388K)

Ref Sequence

ENSEMBL: ENSMUSP00000103405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039269
AA Change: N388K

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: N388K

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	5e-22	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000107775

SMART Domains

Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151

Domain	Start	End	E-Value	Type
Pfam:zf-B_box	12	58	3.9e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107776
AA Change: N388K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: N388K

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	1e-21	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107778
AA Change: N393K

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: N393K

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	5e-22	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago1	T	A	4: 126,448,808	Q514L	probably benign	Het
Alpi	G	C	1: 87,099,462	T365S	probably damaging	Het
Cbx4	A	T	11: 119,081,082	V489E	probably damaging	Het
Ccdc162	T	C	10: 41,627,149	D999G	probably damaging	Het
Clspn	A	G	4: 126,563,947	E88G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ddx1	A	T	12: 13,245,720	I33N	probably damaging	Het
Diaph3	G	A	14: 86,866,486	L821F	probably damaging	Het
Duox2	C	T	2: 122,296,370	M221I	probably benign	Het
Gm15130	A	T	2: 111,135,442	M154K	unknown	Het
Gm3233	G	T	10: 77,759,415		probably benign	Het
Heg1	A	C	16: 33,766,775	I1327L	probably damaging	Het
Ifnar1	G	A	16: 91,505,415		probably null	Het
Itpr1	C	T	6: 108,505,903	L2310F	probably damaging	Het
Olfr1450	T	C	19: 12,954,317	S243P	probably damaging	Het
Pcdhb7	A	G	18: 37,343,434	N541S	possibly damaging	Het
Prelp	A	G	1: 133,914,741	L222P	probably damaging	Het
Prl8a8	A	G	13: 27,508,429	I193T	probably damaging	Het
Prpf4b	G	T	13: 34,900,371	R914L	probably damaging	Het
Ptbp2	G	C	3: 119,720,835	Q448E	probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Slc9a9	A	T	9: 94,670,227	M56L	probably benign	Het
Slfn4	A	G	11: 83,187,174	I263V	possibly damaging	Het
Taar2	A	G	10: 23,941,279	N239S	probably benign	Het
Trrap	T	A	5: 144,790,870	I467N	possibly damaging	Het
Ttc28	T	C	5: 111,276,276	Y1439H	probably damaging	Het
Usp34	A	G	11: 23,488,666	I3409M	probably benign	Het
Znhit2	A	G	19: 6,062,257	N344S	probably damaging	Het

Other mutations in Zbbx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Zbbx	APN	3	75061532	critical splice donor site	probably null
IGL01328:Zbbx	APN	3	75093075	nonsense	probably null
IGL01340:Zbbx	APN	3	75105650	missense	possibly damaging	0.53
IGL01631:Zbbx	APN	3	75078677	missense	probably damaging	0.99
IGL01681:Zbbx	APN	3	75052478	missense	probably damaging	1.00
IGL02427:Zbbx	APN	3	75139598	missense	probably benign	0.04
IGL03077:Zbbx	APN	3	75081846	missense	possibly damaging	0.61
IGL03115:Zbbx	APN	3	75078560	missense	probably benign	0.03
IGL03162:Zbbx	APN	3	75071623	splice site	probably benign
Eland	UTSW	3	75071712	missense	probably benign	0.01
PIT4480001:Zbbx	UTSW	3	75136487	missense	probably damaging	1.00
PIT4495001:Zbbx	UTSW	3	75061637	missense	probably damaging	1.00
R0179:Zbbx	UTSW	3	75085562	splice site	probably benign
R0396:Zbbx	UTSW	3	75078495	missense	possibly damaging	0.81
R0523:Zbbx	UTSW	3	75081858	missense	probably benign	0.03
R0603:Zbbx	UTSW	3	75078450	missense	probably benign	0.05
R0745:Zbbx	UTSW	3	75155427	missense	probably damaging	1.00
R0747:Zbbx	UTSW	3	75155427	missense	probably damaging	1.00
R1208:Zbbx	UTSW	3	75037992	missense	possibly damaging	0.94
R1208:Zbbx	UTSW	3	75037992	missense	possibly damaging	0.94
R1371:Zbbx	UTSW	3	75052477	missense	possibly damaging	0.58
R1769:Zbbx	UTSW	3	75083619	splice site	probably benign
R1906:Zbbx	UTSW	3	75071740	missense	probably damaging	1.00
R2069:Zbbx	UTSW	3	75078412	missense	probably benign	0.01
R2165:Zbbx	UTSW	3	75112107	missense	probably damaging	0.99
R2174:Zbbx	UTSW	3	75052414	missense	possibly damaging	0.93
R2979:Zbbx	UTSW	3	75078486	nonsense	probably null
R3121:Zbbx	UTSW	3	75081846	missense	possibly damaging	0.88
R3755:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R3756:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R3816:Zbbx	UTSW	3	75085495	missense	probably benign	0.00
R4002:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4003:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4057:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4072:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4073:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4075:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4114:Zbbx	UTSW	3	75139598	missense	probably benign	0.04
R4784:Zbbx	UTSW	3	75085041	missense	probably benign	0.05
R4821:Zbbx	UTSW	3	75081747	missense	possibly damaging	0.68
R5008:Zbbx	UTSW	3	75151448	missense	possibly damaging	0.62
R5030:Zbbx	UTSW	3	75083683	missense	possibly damaging	0.83
R5388:Zbbx	UTSW	3	75083670	missense	probably damaging	0.98
R6462:Zbbx	UTSW	3	75078659	missense	probably benign	0.07
R6597:Zbbx	UTSW	3	75136454	missense	probably damaging	1.00
R6882:Zbbx	UTSW	3	75071712	missense	probably benign	0.01
R7084:Zbbx	UTSW	3	75139546	missense	possibly damaging	0.92
R7096:Zbbx	UTSW	3	75081737	missense	probably benign	0.03
R7102:Zbbx	UTSW	3	75112094	missense	probably benign	0.06
R7256:Zbbx	UTSW	3	75039898	missense	probably benign	0.02
R7537:Zbbx	UTSW	3	75085519	missense	probably damaging	1.00
R7836:Zbbx	UTSW	3	75078474	missense	possibly damaging	0.65
R7905:Zbbx	UTSW	3	75085513	missense	probably benign	0.23
R7919:Zbbx	UTSW	3	75078474	missense	possibly damaging	0.65
R7988:Zbbx	UTSW	3	75085513	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GCTATCACCTTAAGCGGCAG -3'
(R):5'- CCAGAGTCCTAACTATTGACTTTTGG -3'

Sequencing Primer
(F):5'- CACCTTAAGCGGCAGTACTTTAATC -3'
(R):5'- CCTAACTATTGACTTTTGGCTTTTG -3'

Posted On

2018-05-04