Incidental Mutation 'R6398:Zbbx'
ID516060
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Namezinc finger, B-box domain containing
Synonyms
MMRRC Submission 044381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6398 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location75037907-75165034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75078565 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 388 (N388K)
Ref Sequence ENSEMBL: ENSMUSP00000103405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039269
AA Change: N388K

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: N388K

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107775
SMART Domains Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151

DomainStartEndE-ValueType
Pfam:zf-B_box 12 58 3.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107776
AA Change: N388K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: N388K

DomainStartEndE-ValueType
Blast:BBOX 13 58 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107778
AA Change: N393K

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: N393K

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 T A 4: 126,448,808 Q514L probably benign Het
Alpi G C 1: 87,099,462 T365S probably damaging Het
Cbx4 A T 11: 119,081,082 V489E probably damaging Het
Ccdc162 T C 10: 41,627,149 D999G probably damaging Het
Clspn A G 4: 126,563,947 E88G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddx1 A T 12: 13,245,720 I33N probably damaging Het
Diaph3 G A 14: 86,866,486 L821F probably damaging Het
Duox2 C T 2: 122,296,370 M221I probably benign Het
Gm15130 A T 2: 111,135,442 M154K unknown Het
Gm3233 G T 10: 77,759,415 probably benign Het
Heg1 A C 16: 33,766,775 I1327L probably damaging Het
Ifnar1 G A 16: 91,505,415 probably null Het
Itpr1 C T 6: 108,505,903 L2310F probably damaging Het
Olfr1450 T C 19: 12,954,317 S243P probably damaging Het
Pcdhb7 A G 18: 37,343,434 N541S possibly damaging Het
Prelp A G 1: 133,914,741 L222P probably damaging Het
Prl8a8 A G 13: 27,508,429 I193T probably damaging Het
Prpf4b G T 13: 34,900,371 R914L probably damaging Het
Ptbp2 G C 3: 119,720,835 Q448E probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc9a9 A T 9: 94,670,227 M56L probably benign Het
Slfn4 A G 11: 83,187,174 I263V possibly damaging Het
Taar2 A G 10: 23,941,279 N239S probably benign Het
Trrap T A 5: 144,790,870 I467N possibly damaging Het
Ttc28 T C 5: 111,276,276 Y1439H probably damaging Het
Usp34 A G 11: 23,488,666 I3409M probably benign Het
Znhit2 A G 19: 6,062,257 N344S probably damaging Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 75061532 critical splice donor site probably null
IGL01328:Zbbx APN 3 75093075 nonsense probably null
IGL01340:Zbbx APN 3 75105650 missense possibly damaging 0.53
IGL01631:Zbbx APN 3 75078677 missense probably damaging 0.99
IGL01681:Zbbx APN 3 75052478 missense probably damaging 1.00
IGL02427:Zbbx APN 3 75139598 missense probably benign 0.04
IGL03077:Zbbx APN 3 75081846 missense possibly damaging 0.61
IGL03115:Zbbx APN 3 75078560 missense probably benign 0.03
IGL03162:Zbbx APN 3 75071623 splice site probably benign
Eland UTSW 3 75071712 missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75136487 missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 75061637 missense probably damaging 1.00
R0179:Zbbx UTSW 3 75085562 splice site probably benign
R0396:Zbbx UTSW 3 75078495 missense possibly damaging 0.81
R0523:Zbbx UTSW 3 75081858 missense probably benign 0.03
R0603:Zbbx UTSW 3 75078450 missense probably benign 0.05
R0745:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R0747:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1371:Zbbx UTSW 3 75052477 missense possibly damaging 0.58
R1769:Zbbx UTSW 3 75083619 splice site probably benign
R1906:Zbbx UTSW 3 75071740 missense probably damaging 1.00
R2069:Zbbx UTSW 3 75078412 missense probably benign 0.01
R2165:Zbbx UTSW 3 75112107 missense probably damaging 0.99
R2174:Zbbx UTSW 3 75052414 missense possibly damaging 0.93
R2979:Zbbx UTSW 3 75078486 nonsense probably null
R3121:Zbbx UTSW 3 75081846 missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3756:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3816:Zbbx UTSW 3 75085495 missense probably benign 0.00
R4002:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4003:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4057:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4072:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4073:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4075:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4114:Zbbx UTSW 3 75139598 missense probably benign 0.04
R4784:Zbbx UTSW 3 75085041 missense probably benign 0.05
R4821:Zbbx UTSW 3 75081747 missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75151448 missense possibly damaging 0.62
R5030:Zbbx UTSW 3 75083683 missense possibly damaging 0.83
R5388:Zbbx UTSW 3 75083670 missense probably damaging 0.98
R6462:Zbbx UTSW 3 75078659 missense probably benign 0.07
R6597:Zbbx UTSW 3 75136454 missense probably damaging 1.00
R6882:Zbbx UTSW 3 75071712 missense probably benign 0.01
R7084:Zbbx UTSW 3 75139546 missense possibly damaging 0.92
R7096:Zbbx UTSW 3 75081737 missense probably benign 0.03
R7102:Zbbx UTSW 3 75112094 missense probably benign 0.06
R7256:Zbbx UTSW 3 75039898 missense probably benign 0.02
R7537:Zbbx UTSW 3 75085519 missense probably damaging 1.00
R7836:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7905:Zbbx UTSW 3 75085513 missense probably benign 0.23
R7919:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7988:Zbbx UTSW 3 75085513 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCTATCACCTTAAGCGGCAG -3'
(R):5'- CCAGAGTCCTAACTATTGACTTTTGG -3'

Sequencing Primer
(F):5'- CACCTTAAGCGGCAGTACTTTAATC -3'
(R):5'- CCTAACTATTGACTTTTGGCTTTTG -3'
Posted On2018-05-04