Mutagenetix > Incidental Mutation

Incidental Mutation 'R6398:Clspn'

516063

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

044381-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6398 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126563947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 88 (E88G)

Ref Sequence

ENSEMBL: ENSMUSP00000120683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795] [ENSMUST00000147675]

AlphaFold

Q80YR7

Predicted Effect

probably damaging
Transcript: ENSMUST00000048391
AA Change: E257G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: E257G

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123695

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000129795
AA Change: E88G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489
AA Change: E88G

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147675

SMART Domains

Protein: ENSMUSP00000116699
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
low complexity region	60	71	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185054

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago1	T	A	4: 126,448,808	Q514L	probably benign	Het
Alpi	G	C	1: 87,099,462	T365S	probably damaging	Het
Cbx4	A	T	11: 119,081,082	V489E	probably damaging	Het
Ccdc162	T	C	10: 41,627,149	D999G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ddx1	A	T	12: 13,245,720	I33N	probably damaging	Het
Diaph3	G	A	14: 86,866,486	L821F	probably damaging	Het
Duox2	C	T	2: 122,296,370	M221I	probably benign	Het
Gm15130	A	T	2: 111,135,442	M154K	unknown	Het
Gm3233	G	T	10: 77,759,415		probably benign	Het
Heg1	A	C	16: 33,766,775	I1327L	probably damaging	Het
Ifnar1	G	A	16: 91,505,415		probably null	Het
Itpr1	C	T	6: 108,505,903	L2310F	probably damaging	Het
Olfr1450	T	C	19: 12,954,317	S243P	probably damaging	Het
Pcdhb7	A	G	18: 37,343,434	N541S	possibly damaging	Het
Prelp	A	G	1: 133,914,741	L222P	probably damaging	Het
Prl8a8	A	G	13: 27,508,429	I193T	probably damaging	Het
Prpf4b	G	T	13: 34,900,371	R914L	probably damaging	Het
Ptbp2	G	C	3: 119,720,835	Q448E	probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Slc9a9	A	T	9: 94,670,227	M56L	probably benign	Het
Slfn4	A	G	11: 83,187,174	I263V	possibly damaging	Het
Taar2	A	G	10: 23,941,279	N239S	probably benign	Het
Trrap	T	A	5: 144,790,870	I467N	possibly damaging	Het
Ttc28	T	C	5: 111,276,276	Y1439H	probably damaging	Het
Usp34	A	G	11: 23,488,666	I3409M	probably benign	Het
Zbbx	G	T	3: 75,078,565	N388K	probably damaging	Het
Znhit2	A	G	19: 6,062,257	N344S	probably damaging	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTAGTGTGGTGTAATAAGAAGCATC -3'
(R):5'- CAGGCAAAACACATGTGGTAC -3'

Sequencing Primer
(F):5'- CCTGGTGGTTGTACTATCCAAGATAC -3'
(R):5'- TGGTACACACACATGCAGAC -3'

Posted On

2018-05-04