Mutagenetix > Incidental Mutations

Incidental Mutation 'R6398:Trrap'

516065

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

MMRRC Submission

044381-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6398 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

144767732-144859778 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144790870 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 467 (I467N)

Ref Sequence

ENSEMBL: ENSMUSP00000148419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038980
AA Change: I467N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: I467N

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094120
AA Change: I467N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: I467N

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100467
AA Change: I467N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: I467N

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000132925
AA Change: I181N

SMART Domains

Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: I181N

Domain	Start	End	E-Value	Type
low complexity region	197	242	N/A	INTRINSIC
low complexity region	244	255	N/A	INTRINSIC
SCOP:d1gw5a_	474	1003	9e-7	SMART
Blast:PI3Kc	480	579	1e-13	BLAST
low complexity region	1083	1092	N/A	INTRINSIC
low complexity region	1572	1583	N/A	INTRINSIC
low complexity region	1606	1621	N/A	INTRINSIC
low complexity region	2029	2043	N/A	INTRINSIC
Pfam:FAT	2570	2914	1.5e-69	PFAM
low complexity region	3121	3134	N/A	INTRINSIC
low complexity region	3165	3176	N/A	INTRINSIC
PI3Kc	3267	3556	5.11e-8	SMART
FATC	3555	3587	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196258

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213013
AA Change: I467N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago1	T	A	4: 126,448,808	Q514L	probably benign	Het
Alpi	G	C	1: 87,099,462	T365S	probably damaging	Het
Cbx4	A	T	11: 119,081,082	V489E	probably damaging	Het
Ccdc162	T	C	10: 41,627,149	D999G	probably damaging	Het
Clspn	A	G	4: 126,563,947	E88G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ddx1	A	T	12: 13,245,720	I33N	probably damaging	Het
Diaph3	G	A	14: 86,866,486	L821F	probably damaging	Het
Duox2	C	T	2: 122,296,370	M221I	probably benign	Het
Gm15130	A	T	2: 111,135,442	M154K	unknown	Het
Gm3233	G	T	10: 77,759,415		probably benign	Het
Heg1	A	C	16: 33,766,775	I1327L	probably damaging	Het
Ifnar1	G	A	16: 91,505,415		probably null	Het
Itpr1	C	T	6: 108,505,903	L2310F	probably damaging	Het
Olfr1450	T	C	19: 12,954,317	S243P	probably damaging	Het
Pcdhb7	A	G	18: 37,343,434	N541S	possibly damaging	Het
Prelp	A	G	1: 133,914,741	L222P	probably damaging	Het
Prl8a8	A	G	13: 27,508,429	I193T	probably damaging	Het
Prpf4b	G	T	13: 34,900,371	R914L	probably damaging	Het
Ptbp2	G	C	3: 119,720,835	Q448E	probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Slc9a9	A	T	9: 94,670,227	M56L	probably benign	Het
Slfn4	A	G	11: 83,187,174	I263V	possibly damaging	Het
Taar2	A	G	10: 23,941,279	N239S	probably benign	Het
Ttc28	T	C	5: 111,276,276	Y1439H	probably damaging	Het
Usp34	A	G	11: 23,488,666	I3409M	probably benign	Het
Zbbx	G	T	3: 75,078,565	N388K	probably damaging	Het
Znhit2	A	G	19: 6,062,257	N344S	probably damaging	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144779974	splice site	probably benign
IGL00470:Trrap	APN	5	144818038	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144825225	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144784255	splice site	probably benign
IGL01087:Trrap	APN	5	144846539	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144804818	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144830969	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144831021	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144833287	splice site	probably benign
IGL01748:Trrap	APN	5	144833340	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144821875	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144856989	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144828494	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144816433	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144840436	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144832538	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144777917	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144798390	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144824550	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144841079	splice site	probably benign
IGL02953:Trrap	APN	5	144815964	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144833186	missense	probably benign	0.00
Buffer	UTSW	5	144834204	missense	probably benign	0.06
Card-tower	UTSW	5	144804766	missense	probably damaging	1.00
Glass_house	UTSW	5	144845477	missense	possibly damaging	0.67
Immovable	UTSW	5	144790855	missense	possibly damaging	0.66
PIT4243001:Trrap	UTSW	5	144796971	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144828600	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0112:Trrap	UTSW	5	144822761	nonsense	probably null
R0126:Trrap	UTSW	5	144805750	nonsense	probably null
R0257:Trrap	UTSW	5	144804235	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144816395	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144816339	missense	probably benign	0.03
R0396:Trrap	UTSW	5	144814556	missense	probably damaging	0.99
R0448:Trrap	UTSW	5	144839567	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144846477	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144853499	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144814830	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144805727	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144777939	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144816409	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144789599	splice site	probably benign
R1374:Trrap	UTSW	5	144846618	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144857422	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144818313	missense	probably benign
R1538:Trrap	UTSW	5	144837202	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144814575	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144828590	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144822703	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144853586	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144830951	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144815917	splice site	probably null
R1902:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144853488	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144803044	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144828562	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144782239	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144825874	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R2174:Trrap	UTSW	5	144821855	missense	probably benign	0.40
R2442:Trrap	UTSW	5	144817966	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144843369	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144792252	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144792165	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144843318	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144831048	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144825321	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144792118	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144785480	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144803277	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144832488	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144800948	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144845592	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144805735	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144805720	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144856960	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144826717	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144851179	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144817786	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144813503	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144844224	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144849977	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144782265	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144830945	missense	probably benign
R5885:Trrap	UTSW	5	144794793	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144849920	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144786708	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144807391	splice site	silent
R5992:Trrap	UTSW	5	144810184	missense	probably benign	0.00
R6017:Trrap	UTSW	5	144844241	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144817679	missense	possibly damaging	0.94
R6029:Trrap	UTSW	5	144825914	missense	possibly damaging	0.75
R6117:Trrap	UTSW	5	144802961	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144781981	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144839713	splice site	probably null
R6288:Trrap	UTSW	5	144811992	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144805018	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144813526	missense	probably benign	0.02
R6413:Trrap	UTSW	5	144784046	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144857002	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144834204	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144815550	critical splice donor site	probably null
R6631:Trrap	UTSW	5	144771650	missense	possibly damaging	0.94
R6727:Trrap	UTSW	5	144856950	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144851256	nonsense	probably null
R6914:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144790855	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144792154	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144803178	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144821803	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144839614	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144794049	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144842707	missense	possibly damaging	0.94
R7215:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7255:Trrap	UTSW	5	144858954	missense	probably damaging	1.00
R7261:Trrap	UTSW	5	144845477	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144814523	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144789398	missense	probably benign
R7447:Trrap	UTSW	5	144839474	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144851209	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144832511	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144777146	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144835897	splice site	probably null
R8183:Trrap	UTSW	5	144828533	missense	probably benign	0.01
R8265:Trrap	UTSW	5	144785534	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144791165	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144825937	missense	probably benign	0.44
X0060:Trrap	UTSW	5	144843361	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144834197	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144810344	missense
Z1177:Trrap	UTSW	5	144819708	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144856951	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTTGAACTCAGGACCTTTGGAAG -3'
(R):5'- TGGAACGTCTGCTTGTCCTC -3'

Sequencing Primer
(F):5'- CTCAGGACCTTTGGAAGAGCAGTC -3'
(R):5'- CTTGCTTCTCAAATGGGGGCAC -3'

Posted On

2018-05-04