Incidental Mutation 'R6398:Slc9a9'
ID516069
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
MMRRC Submission 044381-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6398 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94670227 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 56 (M56L)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect probably benign
Transcript: ENSMUST00000033463
AA Change: M56L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: M56L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188551
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 T A 4: 126,448,808 Q514L probably benign Het
Alpi G C 1: 87,099,462 T365S probably damaging Het
Cbx4 A T 11: 119,081,082 V489E probably damaging Het
Ccdc162 T C 10: 41,627,149 D999G probably damaging Het
Clspn A G 4: 126,563,947 E88G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddx1 A T 12: 13,245,720 I33N probably damaging Het
Diaph3 G A 14: 86,866,486 L821F probably damaging Het
Duox2 C T 2: 122,296,370 M221I probably benign Het
Gm15130 A T 2: 111,135,442 M154K unknown Het
Gm3233 G T 10: 77,759,415 probably benign Het
Heg1 A C 16: 33,766,775 I1327L probably damaging Het
Ifnar1 G A 16: 91,505,415 probably null Het
Itpr1 C T 6: 108,505,903 L2310F probably damaging Het
Olfr1450 T C 19: 12,954,317 S243P probably damaging Het
Pcdhb7 A G 18: 37,343,434 N541S possibly damaging Het
Prelp A G 1: 133,914,741 L222P probably damaging Het
Prl8a8 A G 13: 27,508,429 I193T probably damaging Het
Prpf4b G T 13: 34,900,371 R914L probably damaging Het
Ptbp2 G C 3: 119,720,835 Q448E probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slfn4 A G 11: 83,187,174 I263V possibly damaging Het
Taar2 A G 10: 23,941,279 N239S probably benign Het
Trrap T A 5: 144,790,870 I467N possibly damaging Het
Ttc28 T C 5: 111,276,276 Y1439H probably damaging Het
Usp34 A G 11: 23,488,666 I3409M probably benign Het
Zbbx G T 3: 75,078,565 N388K probably damaging Het
Znhit2 A G 19: 6,062,257 N344S probably damaging Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0306:Slc9a9 UTSW 9 95137934 missense probably benign
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4167:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4170:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6317:Slc9a9 UTSW 9 94939459 missense possibly damaging 0.51
R6476:Slc9a9 UTSW 9 94685138 missense probably benign 0.00
R6501:Slc9a9 UTSW 9 94936371 missense probably benign 0.01
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6611:Slc9a9 UTSW 9 94939478 missense probably benign 0.18
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8412:Slc9a9 UTSW 9 95229039 missense probably damaging 1.00
R8501:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8514:Slc9a9 UTSW 9 94936365 missense probably benign 0.01
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TTCTCTGAGCATCACAGTCGG -3'
(R):5'- CTCTGTGGTCAGGCGGAATTTC -3'

Sequencing Primer
(F):5'- TGAGCATCACAGTCGGTCGAG -3'
(R):5'- TCTGCCGCTCCTCTGGAAAG -3'
Posted On2018-05-04