Incidental Mutation 'R6398:Cbx4'
ID516075
Institutional Source Beutler Lab
Gene Symbol Cbx4
Ensembl Gene ENSMUSG00000039989
Gene Namechromobox 4
SynonymsPC2, MPc2
MMRRC Submission 044381-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6398 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location119077573-119086221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119081082 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 489 (V489E)
Ref Sequence ENSEMBL: ENSMUSP00000026665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026665]
Predicted Effect probably damaging
Transcript: ENSMUST00000026665
AA Change: V489E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026665
Gene: ENSMUSG00000039989
AA Change: V489E

DomainStartEndE-ValueType
CHROMO 10 62 5.23e-20 SMART
low complexity region 138 152 N/A INTRINSIC
low complexity region 209 230 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
low complexity region 488 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181285
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in complete neonatal lethality and severe thymus hypoplasia as a result of reduced thymocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 T A 4: 126,448,808 Q514L probably benign Het
Alpi G C 1: 87,099,462 T365S probably damaging Het
Ccdc162 T C 10: 41,627,149 D999G probably damaging Het
Clspn A G 4: 126,563,947 E88G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddx1 A T 12: 13,245,720 I33N probably damaging Het
Diaph3 G A 14: 86,866,486 L821F probably damaging Het
Duox2 C T 2: 122,296,370 M221I probably benign Het
Gm15130 A T 2: 111,135,442 M154K unknown Het
Gm3233 G T 10: 77,759,415 probably benign Het
Heg1 A C 16: 33,766,775 I1327L probably damaging Het
Ifnar1 G A 16: 91,505,415 probably null Het
Itpr1 C T 6: 108,505,903 L2310F probably damaging Het
Olfr1450 T C 19: 12,954,317 S243P probably damaging Het
Pcdhb7 A G 18: 37,343,434 N541S possibly damaging Het
Prelp A G 1: 133,914,741 L222P probably damaging Het
Prl8a8 A G 13: 27,508,429 I193T probably damaging Het
Prpf4b G T 13: 34,900,371 R914L probably damaging Het
Ptbp2 G C 3: 119,720,835 Q448E probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc9a9 A T 9: 94,670,227 M56L probably benign Het
Slfn4 A G 11: 83,187,174 I263V possibly damaging Het
Taar2 A G 10: 23,941,279 N239S probably benign Het
Trrap T A 5: 144,790,870 I467N possibly damaging Het
Ttc28 T C 5: 111,276,276 Y1439H probably damaging Het
Usp34 A G 11: 23,488,666 I3409M probably benign Het
Zbbx G T 3: 75,078,565 N388K probably damaging Het
Znhit2 A G 19: 6,062,257 N344S probably damaging Het
Other mutations in Cbx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02456:Cbx4 APN 11 119082112 nonsense probably null
R1034:Cbx4 UTSW 11 119081707 missense probably damaging 1.00
R2113:Cbx4 UTSW 11 119081892 missense probably damaging 1.00
R4995:Cbx4 UTSW 11 119081211 missense probably benign 0.01
R5226:Cbx4 UTSW 11 119081928 missense probably damaging 0.99
R5893:Cbx4 UTSW 11 119082190 missense probably damaging 1.00
R7140:Cbx4 UTSW 11 119081928 missense probably damaging 0.99
R7811:Cbx4 UTSW 11 119081572 missense probably benign 0.00
X0064:Cbx4 UTSW 11 119084593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCGTCACGTATTCCTTGAAAG -3'
(R):5'- CCTGTAAGAAGCGGTTGACC -3'

Sequencing Primer
(F):5'- CACGTATTCCTTGAAAGTGACGG -3'
(R):5'- ATCAGCACGCCGACCTG -3'
Posted On2018-05-04