Incidental Mutation 'R6398:Ddx1'
ID 516076
Institutional Source Beutler Lab
Gene Symbol Ddx1
Ensembl Gene ENSMUSG00000037149
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Synonyms
MMRRC Submission 044381-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6398 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 13216973-13249213 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13245720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 33 (I33N)
Ref Sequence ENSEMBL: ENSMUSP00000065987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071103] [ENSMUST00000221623]
AlphaFold Q91VR5
Predicted Effect probably damaging
Transcript: ENSMUST00000071103
AA Change: I33N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065987
Gene: ENSMUSG00000037149
AA Change: I33N

DomainStartEndE-ValueType
DEXDc 21 444 1.95e-47 SMART
SPRY 130 246 1.91e-34 SMART
HELICc 520 610 8.28e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221623
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 T A 4: 126,448,808 Q514L probably benign Het
Alpi G C 1: 87,099,462 T365S probably damaging Het
Cbx4 A T 11: 119,081,082 V489E probably damaging Het
Ccdc162 T C 10: 41,627,149 D999G probably damaging Het
Clspn A G 4: 126,563,947 E88G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Diaph3 G A 14: 86,866,486 L821F probably damaging Het
Duox2 C T 2: 122,296,370 M221I probably benign Het
Gm15130 A T 2: 111,135,442 M154K unknown Het
Gm3233 G T 10: 77,759,415 probably benign Het
Heg1 A C 16: 33,766,775 I1327L probably damaging Het
Ifnar1 G A 16: 91,505,415 probably null Het
Itpr1 C T 6: 108,505,903 L2310F probably damaging Het
Olfr1450 T C 19: 12,954,317 S243P probably damaging Het
Pcdhb7 A G 18: 37,343,434 N541S possibly damaging Het
Prelp A G 1: 133,914,741 L222P probably damaging Het
Prl8a8 A G 13: 27,508,429 I193T probably damaging Het
Prpf4b G T 13: 34,900,371 R914L probably damaging Het
Ptbp2 G C 3: 119,720,835 Q448E probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc9a9 A T 9: 94,670,227 M56L probably benign Het
Slfn4 A G 11: 83,187,174 I263V possibly damaging Het
Taar2 A G 10: 23,941,279 N239S probably benign Het
Trrap T A 5: 144,790,870 I467N possibly damaging Het
Ttc28 T C 5: 111,276,276 Y1439H probably damaging Het
Usp34 A G 11: 23,488,666 I3409M probably benign Het
Zbbx G T 3: 75,078,565 N388K probably damaging Het
Znhit2 A G 19: 6,062,257 N344S probably damaging Het
Other mutations in Ddx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ddx1 APN 12 13227459 splice site probably benign
IGL00725:Ddx1 APN 12 13245690 missense probably damaging 1.00
IGL00958:Ddx1 APN 12 13240848 splice site probably null
IGL01786:Ddx1 APN 12 13229136 missense probably benign
IGL02832:Ddx1 APN 12 13227317 nonsense probably null
IGL02983:Ddx1 APN 12 13223862 missense probably damaging 1.00
R0201:Ddx1 UTSW 12 13223808 missense probably damaging 1.00
R0931:Ddx1 UTSW 12 13237817 splice site probably benign
R1434:Ddx1 UTSW 12 13237231 missense probably benign 0.01
R1558:Ddx1 UTSW 12 13239541 missense probably damaging 1.00
R1673:Ddx1 UTSW 12 13244966 critical splice donor site probably null
R1854:Ddx1 UTSW 12 13229331 missense probably benign 0.19
R2910:Ddx1 UTSW 12 13231440 splice site probably null
R2911:Ddx1 UTSW 12 13231440 splice site probably null
R4181:Ddx1 UTSW 12 13231503 nonsense probably null
R4182:Ddx1 UTSW 12 13231503 nonsense probably null
R4183:Ddx1 UTSW 12 13231503 nonsense probably null
R4231:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4234:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4235:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4243:Ddx1 UTSW 12 13240909 nonsense probably null
R4717:Ddx1 UTSW 12 13240887 missense probably damaging 1.00
R4821:Ddx1 UTSW 12 13239147 missense probably damaging 1.00
R5032:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R5082:Ddx1 UTSW 12 13220435 nonsense probably null
R5528:Ddx1 UTSW 12 13229294 missense probably damaging 1.00
R5997:Ddx1 UTSW 12 13237799 missense probably damaging 1.00
R6891:Ddx1 UTSW 12 13236095 missense probably benign 0.25
R7085:Ddx1 UTSW 12 13229355 missense probably damaging 1.00
R7125:Ddx1 UTSW 12 13243863 missense probably benign 0.18
R7307:Ddx1 UTSW 12 13223959 missense probably damaging 1.00
R7388:Ddx1 UTSW 12 13225455 missense probably null 1.00
R7393:Ddx1 UTSW 12 13230353 missense probably benign 0.03
R7460:Ddx1 UTSW 12 13231439 splice site probably null
R8310:Ddx1 UTSW 12 13224279 intron probably benign
R8479:Ddx1 UTSW 12 13220748 missense probably damaging 0.97
R8712:Ddx1 UTSW 12 13243858 critical splice donor site probably benign
R8790:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R8826:Ddx1 UTSW 12 13227331 missense probably damaging 1.00
R9120:Ddx1 UTSW 12 13225457 missense possibly damaging 0.89
R9214:Ddx1 UTSW 12 13236118 missense probably benign
R9400:Ddx1 UTSW 12 13223702 missense probably damaging 1.00
X0011:Ddx1 UTSW 12 13229415 missense probably damaging 1.00
X0028:Ddx1 UTSW 12 13243866 missense probably benign 0.00
Z1177:Ddx1 UTSW 12 13229259 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCCTATTCCCACAGCTTC -3'
(R):5'- GGTGCAATTGTGACATATCTTTCC -3'

Sequencing Primer
(F):5'- AGGCCTATTCCCACAGCTTCTATAG -3'
(R):5'- TCAGTTCATGCTGATTCTTTAGATC -3'
Posted On 2018-05-04