Mutagenetix > Incidental Mutation

Incidental Mutation 'R6398:Prpf4b'

516078

Institutional Source

Beutler Lab

Gene Symbol

Prpf4b

Ensembl Gene

ENSMUSG00000021413

Gene Name

pre-mRNA processing factor 4B

Synonyms

Prp4, Prp4k, Prpk

MMRRC Submission

044381-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6398 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34875302-34906064 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 34900371 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 914 (R914L)

Ref Sequence

ENSEMBL: ENSMUSP00000152654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]

AlphaFold

Q61136

Predicted Effect

probably damaging
Transcript: ENSMUST00000077853
AA Change: R914L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: R914L

Domain	Start	End	E-Value	Type
low complexity region	40	62	N/A	INTRINSIC
low complexity region	68	80	N/A	INTRINSIC
coiled coil region	102	123	N/A	INTRINSIC
low complexity region	142	150	N/A	INTRINSIC
low complexity region	156	170	N/A	INTRINSIC
low complexity region	178	197	N/A	INTRINSIC
low complexity region	210	233	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
low complexity region	284	294	N/A	INTRINSIC
low complexity region	299	324	N/A	INTRINSIC
low complexity region	340	360	N/A	INTRINSIC
low complexity region	390	417	N/A	INTRINSIC
low complexity region	435	497	N/A	INTRINSIC
low complexity region	521	535	N/A	INTRINSIC
low complexity region	562	581	N/A	INTRINSIC
S_TKc	687	1003	4.99e-74	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220965

Predicted Effect

probably benign
Transcript: ENSMUST00000221077

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221087

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221156

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221784

Predicted Effect

probably damaging
Transcript: ENSMUST00000222509
AA Change: R914L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222834

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223228

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago1	T	A	4: 126,448,808	Q514L	probably benign	Het
Alpi	G	C	1: 87,099,462	T365S	probably damaging	Het
Cbx4	A	T	11: 119,081,082	V489E	probably damaging	Het
Ccdc162	T	C	10: 41,627,149	D999G	probably damaging	Het
Clspn	A	G	4: 126,563,947	E88G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ddx1	A	T	12: 13,245,720	I33N	probably damaging	Het
Diaph3	G	A	14: 86,866,486	L821F	probably damaging	Het
Duox2	C	T	2: 122,296,370	M221I	probably benign	Het
Gm15130	A	T	2: 111,135,442	M154K	unknown	Het
Gm3233	G	T	10: 77,759,415		probably benign	Het
Heg1	A	C	16: 33,766,775	I1327L	probably damaging	Het
Ifnar1	G	A	16: 91,505,415		probably null	Het
Itpr1	C	T	6: 108,505,903	L2310F	probably damaging	Het
Olfr1450	T	C	19: 12,954,317	S243P	probably damaging	Het
Pcdhb7	A	G	18: 37,343,434	N541S	possibly damaging	Het
Prelp	A	G	1: 133,914,741	L222P	probably damaging	Het
Prl8a8	A	G	13: 27,508,429	I193T	probably damaging	Het
Ptbp2	G	C	3: 119,720,835	Q448E	probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Slc9a9	A	T	9: 94,670,227	M56L	probably benign	Het
Slfn4	A	G	11: 83,187,174	I263V	possibly damaging	Het
Taar2	A	G	10: 23,941,279	N239S	probably benign	Het
Trrap	T	A	5: 144,790,870	I467N	possibly damaging	Het
Ttc28	T	C	5: 111,276,276	Y1439H	probably damaging	Het
Usp34	A	G	11: 23,488,666	I3409M	probably benign	Het
Zbbx	G	T	3: 75,078,565	N388K	probably damaging	Het
Znhit2	A	G	19: 6,062,257	N344S	probably damaging	Het

Other mutations in Prpf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Prpf4b	APN	13	34883907	missense	probably benign	0.23
IGL00639:Prpf4b	APN	13	34899173	missense	possibly damaging	0.70
IGL00901:Prpf4b	APN	13	34894482	missense	probably damaging	1.00
IGL01301:Prpf4b	APN	13	34884291	missense	probably benign	0.23
IGL02027:Prpf4b	APN	13	34889571	missense	probably benign	0.35
IGL02111:Prpf4b	APN	13	34883961	missense	probably benign	0.23
IGL02256:Prpf4b	APN	13	34899878	missense	probably damaging	0.98
IGL02590:Prpf4b	APN	13	34888146	unclassified	probably benign
IGL03389:Prpf4b	APN	13	34900456	splice site	probably benign
IGL03411:Prpf4b	APN	13	34895359	missense	probably damaging	1.00
ANU18:Prpf4b	UTSW	13	34884291	missense	probably benign	0.23
PIT4260001:Prpf4b	UTSW	13	34884291	missense	probably benign	0.23
PIT4696001:Prpf4b	UTSW	13	34899842	missense	probably benign	0.01
R0114:Prpf4b	UTSW	13	34890488	splice site	probably benign
R0157:Prpf4b	UTSW	13	34884031	unclassified	probably benign
R1551:Prpf4b	UTSW	13	34894443	missense	possibly damaging	0.91
R1587:Prpf4b	UTSW	13	34892150	missense	probably benign	0.09
R2105:Prpf4b	UTSW	13	34884231	unclassified	probably benign
R2152:Prpf4b	UTSW	13	34900419	missense	probably benign	0.04
R2432:Prpf4b	UTSW	13	34883341	unclassified	probably benign
R3802:Prpf4b	UTSW	13	34883682	unclassified	probably benign
R3803:Prpf4b	UTSW	13	34883682	unclassified	probably benign
R3804:Prpf4b	UTSW	13	34883682	unclassified	probably benign
R3982:Prpf4b	UTSW	13	34884213	unclassified	probably benign
R4603:Prpf4b	UTSW	13	34888164	unclassified	probably benign
R4633:Prpf4b	UTSW	13	34900442	missense	probably damaging	1.00
R4649:Prpf4b	UTSW	13	34899971	missense	probably benign	0.06
R4651:Prpf4b	UTSW	13	34899971	missense	probably benign	0.06
R4653:Prpf4b	UTSW	13	34899971	missense	probably benign	0.06
R5022:Prpf4b	UTSW	13	34883599	unclassified	probably benign
R5028:Prpf4b	UTSW	13	34899975	missense	probably damaging	1.00
R5232:Prpf4b	UTSW	13	34883590	unclassified	probably benign
R5313:Prpf4b	UTSW	13	34894549	missense	probably damaging	1.00
R5440:Prpf4b	UTSW	13	34884093	unclassified	probably benign
R5511:Prpf4b	UTSW	13	34884054	unclassified	probably benign
R5863:Prpf4b	UTSW	13	34899128	missense	possibly damaging	0.51
R5981:Prpf4b	UTSW	13	34886710	missense	probably benign	0.23
R6360:Prpf4b	UTSW	13	34901433	missense	probably damaging	0.99
R6556:Prpf4b	UTSW	13	34896032	missense	probably damaging	0.98
R6880:Prpf4b	UTSW	13	34894453	missense	possibly damaging	0.69
R7133:Prpf4b	UTSW	13	34901494	missense	probably benign	0.02
R7148:Prpf4b	UTSW	13	34894472	missense	probably benign	0.04
R7208:Prpf4b	UTSW	13	34884011	missense	unknown
R7966:Prpf4b	UTSW	13	34901445	missense	probably damaging	0.96
R8241:Prpf4b	UTSW	13	34895991	missense	probably damaging	1.00
R8298:Prpf4b	UTSW	13	34888183	missense	unknown
R9609:Prpf4b	UTSW	13	34884049	missense	unknown
R9710:Prpf4b	UTSW	13	34899887	missense	probably damaging	1.00
RF002:Prpf4b	UTSW	13	34884236	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCACTGAGTGCGCTAGAGAAG -3'
(R):5'- GTCACTTTAGAAGCAGCCACAG -3'

Sequencing Primer
(F):5'- GGTGGCTAAGCACTGCAGAC -3'
(R):5'- AGAACTCCCTCCCTCTGCTCTAATAG -3'

Posted On

2018-05-04