Incidental Mutation 'R6398:Znhit2'
ID516083
Institutional Source Beutler Lab
Gene Symbol Znhit2
Ensembl Gene ENSMUSG00000075227
Gene Namezinc finger, HIT domain containing 2
SynonymsORF6, Znhit2-ps
MMRRC Submission 044381-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R6398 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6061192-6062472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6062257 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 344 (N344S)
Ref Sequence ENSEMBL: ENSMUSP00000134031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007482] [ENSMUST00000025713] [ENSMUST00000043074] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000160028] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000161718] [ENSMUST00000162726] [ENSMUST00000162810] [ENSMUST00000179142] [ENSMUST00000178310] [ENSMUST00000162575]
Predicted Effect probably benign
Transcript: ENSMUST00000007482
SMART Domains Protein: ENSMUSP00000007482
Gene: ENSMUSG00000007338

DomainStartEndE-ValueType
Pfam:Img2 82 166 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025713
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043074
SMART Domains Protein: ENSMUSP00000042835
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 133 9.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113543
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159084
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159836
Predicted Effect probably benign
Transcript: ENSMUST00000160028
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160417
Predicted Effect probably benign
Transcript: ENSMUST00000161090
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161528
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161718
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162549
Predicted Effect probably damaging
Transcript: ENSMUST00000162726
AA Change: N344S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134031
Gene: ENSMUSG00000075227
AA Change: N344S

DomainStartEndE-ValueType
Pfam:zf-HIT 3 36 2e-15 PFAM
low complexity region 54 97 N/A INTRINSIC
low complexity region 120 140 N/A INTRINSIC
low complexity region 167 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179142
SMART Domains Protein: ENSMUSP00000136358
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 132 6.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178310
SMART Domains Protein: ENSMUSP00000136803
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 133 9.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162575
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162721
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 T A 4: 126,448,808 Q514L probably benign Het
Alpi G C 1: 87,099,462 T365S probably damaging Het
Cbx4 A T 11: 119,081,082 V489E probably damaging Het
Ccdc162 T C 10: 41,627,149 D999G probably damaging Het
Clspn A G 4: 126,563,947 E88G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddx1 A T 12: 13,245,720 I33N probably damaging Het
Diaph3 G A 14: 86,866,486 L821F probably damaging Het
Duox2 C T 2: 122,296,370 M221I probably benign Het
Gm15130 A T 2: 111,135,442 M154K unknown Het
Gm3233 G T 10: 77,759,415 probably benign Het
Heg1 A C 16: 33,766,775 I1327L probably damaging Het
Ifnar1 G A 16: 91,505,415 probably null Het
Itpr1 C T 6: 108,505,903 L2310F probably damaging Het
Olfr1450 T C 19: 12,954,317 S243P probably damaging Het
Pcdhb7 A G 18: 37,343,434 N541S possibly damaging Het
Prelp A G 1: 133,914,741 L222P probably damaging Het
Prl8a8 A G 13: 27,508,429 I193T probably damaging Het
Prpf4b G T 13: 34,900,371 R914L probably damaging Het
Ptbp2 G C 3: 119,720,835 Q448E probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc9a9 A T 9: 94,670,227 M56L probably benign Het
Slfn4 A G 11: 83,187,174 I263V possibly damaging Het
Taar2 A G 10: 23,941,279 N239S probably benign Het
Trrap T A 5: 144,790,870 I467N possibly damaging Het
Ttc28 T C 5: 111,276,276 Y1439H probably damaging Het
Usp34 A G 11: 23,488,666 I3409M probably benign Het
Zbbx G T 3: 75,078,565 N388K probably damaging Het
Other mutations in Znhit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1241:Znhit2 UTSW 19 6062258 missense probably damaging 1.00
R2125:Znhit2 UTSW 19 6062061 missense probably benign 0.45
R2126:Znhit2 UTSW 19 6062061 missense probably benign 0.45
R2270:Znhit2 UTSW 19 6061231 missense probably damaging 0.99
R7477:Znhit2 UTSW 19 6062471 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAAGTTGCCCGAATCCTGC -3'
(R):5'- AAAAGGCACTGCTGACATTCG -3'

Sequencing Primer
(F):5'- AATCCTGCTGGGCGAGG -3'
(R):5'- TGGATACCCAGTTCAGCCAG -3'
Posted On2018-05-04