Incidental Mutation 'R6399:A430033K04Rik'
ID516097
Institutional Source Beutler Lab
Gene Symbol A430033K04Rik
Ensembl Gene ENSMUSG00000056014
Gene NameRIKEN cDNA A430033K04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6399 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138622859-138652414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138647559 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 569 (C569R)
Ref Sequence ENSEMBL: ENSMUSP00000142904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069862] [ENSMUST00000198958]
Predicted Effect probably damaging
Transcript: ENSMUST00000069862
AA Change: C569R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067316
Gene: ENSMUSG00000056014
AA Change: C569R

DomainStartEndE-ValueType
KRAB 16 76 6.23e-34 SMART
ZnF_C2H2 261 280 1.01e2 SMART
ZnF_C2H2 455 477 1.47e-3 SMART
ZnF_C2H2 483 505 4.05e-1 SMART
ZnF_C2H2 511 533 5.5e-3 SMART
ZnF_C2H2 539 561 7.26e-3 SMART
ZnF_C2H2 567 589 5.14e-3 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 1.92e-2 SMART
ZnF_C2H2 651 673 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198958
AA Change: C569R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142904
Gene: ENSMUSG00000056014
AA Change: C569R

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
ZnF_C2H2 261 280 4.2e-1 SMART
ZnF_C2H2 455 477 6.4e-6 SMART
ZnF_C2H2 483 505 1.8e-3 SMART
ZnF_C2H2 511 533 2.3e-5 SMART
ZnF_C2H2 539 561 3e-5 SMART
ZnF_C2H2 567 589 2.1e-5 SMART
ZnF_C2H2 595 617 1.5e-5 SMART
ZnF_C2H2 623 643 2.7e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,430,055 W207R probably damaging Het
Apbb2 C T 5: 66,451,467 probably null Het
Atad2b T C 12: 4,957,558 V415A probably damaging Het
Ccdc150 G A 1: 54,263,957 probably null Het
Chd7 A G 4: 8,828,274 T1072A probably damaging Het
Depdc1b T A 13: 108,324,046 F63L probably damaging Het
Dnah2 C T 11: 69,458,518 V2431M probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Flnc A G 6: 29,458,883 E2421G probably damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Kcna4 T C 2: 107,296,549 S543P probably damaging Het
Lrrc30 T A 17: 67,632,686 probably benign Het
Msh6 T A 17: 87,986,891 S1025T probably damaging Het
Ndrg3 C G 2: 156,940,374 A191P probably damaging Het
Olfr259 C T 2: 87,107,986 V134I probably benign Het
Olfr467 A G 7: 107,814,754 T57A possibly damaging Het
Olfr99 T C 17: 37,279,775 Y215C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rnf34 T C 5: 122,861,776 F32L probably benign Het
Serpinb9g A T 13: 33,492,851 L205F probably benign Het
Tbc1d24 T A 17: 24,208,329 I220F probably damaging Het
Thsd7b A T 1: 129,816,648 T758S probably benign Het
Trak1 A G 9: 121,453,496 probably null Het
Ttn T G 2: 76,726,062 S30200R probably damaging Het
Ttn G C 2: 76,726,063 F30199L probably benign Het
Uggt1 T C 1: 36,163,366 D1050G possibly damaging Het
Veph1 T A 3: 66,125,891 S605C probably benign Het
Wbp1 A G 6: 83,120,001 probably benign Het
Ythdc2 C A 18: 44,886,402 Q1413K possibly damaging Het
Other mutations in A430033K04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:A430033K04Rik APN 5 138647592 missense probably damaging 1.00
IGL00336:A430033K04Rik APN 5 138647104 missense probably damaging 0.99
IGL02615:A430033K04Rik APN 5 138646140 nonsense probably null
IGL03354:A430033K04Rik APN 5 138646779 missense possibly damaging 0.85
R0172:A430033K04Rik UTSW 5 138647316 missense probably damaging 0.99
R1769:A430033K04Rik UTSW 5 138646257 missense probably benign 0.04
R4515:A430033K04Rik UTSW 5 138647744 missense probably damaging 1.00
R4903:A430033K04Rik UTSW 5 138646857 nonsense probably null
R4964:A430033K04Rik UTSW 5 138646857 nonsense probably null
R5389:A430033K04Rik UTSW 5 138646297 missense probably benign 0.02
R5769:A430033K04Rik UTSW 5 138646333 missense possibly damaging 0.86
R6128:A430033K04Rik UTSW 5 138647776 missense probably damaging 1.00
R6444:A430033K04Rik UTSW 5 138639569 small deletion probably benign
R6600:A430033K04Rik UTSW 5 138647448 frame shift probably null
R6774:A430033K04Rik UTSW 5 138646450 missense probably benign
R7098:A430033K04Rik UTSW 5 138646522 missense probably benign
R7217:A430033K04Rik UTSW 5 138646926 missense probably benign
R7269:A430033K04Rik UTSW 5 138646752 missense possibly damaging 0.86
R7429:A430033K04Rik UTSW 5 138636183 missense possibly damaging 0.92
R7442:A430033K04Rik UTSW 5 138647247 missense possibly damaging 0.55
R7718:A430033K04Rik UTSW 5 138647860 missense possibly damaging 0.73
R8007:A430033K04Rik UTSW 5 138646639 missense probably benign 0.33
R8170:A430033K04Rik UTSW 5 138647053 missense possibly damaging 0.72
R8348:A430033K04Rik UTSW 5 138636252 missense probably damaging 1.00
R8496:A430033K04Rik UTSW 5 138646858 missense probably benign 0.00
R8520:A430033K04Rik UTSW 5 138646706 missense possibly damaging 0.72
R8778:A430033K04Rik UTSW 5 138646887 missense possibly damaging 0.53
R8858:A430033K04Rik UTSW 5 138640076 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTACGTTTCAAGCCCCACG -3'
(R):5'- CATTCGTAGGCTCTCTCACCAG -3'

Sequencing Primer
(F):5'- ATGCAGGAAAGCCTTCTGTC -3'
(R):5'- CACCAGTGTGAGTTGTCTCG -3'
Posted On2018-05-04