Incidental Mutation 'R6399:Dnajc14'
ID516104
Institutional Source Beutler Lab
Gene Symbol Dnajc14
Ensembl Gene ENSMUSG00000025354
Gene NameDnaJ heat shock protein family (Hsp40) member C14
SynonymsDRIP78, LIP6, HDJ3, 5730551F12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6399 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128804062-128819446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128807490 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 427 (E427G)
Ref Sequence ENSEMBL: ENSMUSP00000151343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026410] [ENSMUST00000051011] [ENSMUST00000139227] [ENSMUST00000217745] [ENSMUST00000218001] [ENSMUST00000218511] [ENSMUST00000219508]
Predicted Effect probably damaging
Transcript: ENSMUST00000026410
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026410
Gene: ENSMUSG00000025354
AA Change: E427G

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
DnaJ 443 500 1.3e-21 SMART
Pfam:Jiv90 532 621 5.9e-40 PFAM
low complexity region 690 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051011
SMART Domains Protein: ENSMUSP00000050451
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 43 240 2.4e-47 PFAM
low complexity region 257 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139227
SMART Domains Protein: ENSMUSP00000118082
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 96 4.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152966
SMART Domains Protein: ENSMUSP00000117574
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 241 1.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217745
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000218001
Predicted Effect probably benign
Transcript: ENSMUST00000218511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219473
Predicted Effect probably damaging
Transcript: ENSMUST00000219508
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1645 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,647,559 C569R probably damaging Het
Acadsb T A 7: 131,430,055 W207R probably damaging Het
Apbb2 C T 5: 66,451,467 probably null Het
Atad2b T C 12: 4,957,558 V415A probably damaging Het
Ccdc150 G A 1: 54,263,957 probably null Het
Chd7 A G 4: 8,828,274 T1072A probably damaging Het
Depdc1b T A 13: 108,324,046 F63L probably damaging Het
Dnah2 C T 11: 69,458,518 V2431M probably damaging Het
Flnc A G 6: 29,458,883 E2421G probably damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Kcna4 T C 2: 107,296,549 S543P probably damaging Het
Lrrc30 T A 17: 67,632,686 probably benign Het
Msh6 T A 17: 87,986,891 S1025T probably damaging Het
Ndrg3 C G 2: 156,940,374 A191P probably damaging Het
Olfr259 C T 2: 87,107,986 V134I probably benign Het
Olfr467 A G 7: 107,814,754 T57A possibly damaging Het
Olfr99 T C 17: 37,279,775 Y215C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rnf34 T C 5: 122,861,776 F32L probably benign Het
Serpinb9g A T 13: 33,492,851 L205F probably benign Het
Tbc1d24 T A 17: 24,208,329 I220F probably damaging Het
Thsd7b A T 1: 129,816,648 T758S probably benign Het
Trak1 A G 9: 121,453,496 probably null Het
Ttn T G 2: 76,726,062 S30200R probably damaging Het
Ttn G C 2: 76,726,063 F30199L probably benign Het
Uggt1 T C 1: 36,163,366 D1050G possibly damaging Het
Veph1 T A 3: 66,125,891 S605C probably benign Het
Wbp1 A G 6: 83,120,001 probably benign Het
Ythdc2 C A 18: 44,886,402 Q1413K possibly damaging Het
Other mutations in Dnajc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Dnajc14 APN 10 128806332 missense probably damaging 1.00
IGL00924:Dnajc14 APN 10 128817319 missense probably benign
IGL00943:Dnajc14 APN 10 128816806 missense possibly damaging 0.92
IGL02833:Dnajc14 APN 10 128806599 missense possibly damaging 0.94
IGL02799:Dnajc14 UTSW 10 128806856 missense possibly damaging 0.88
PIT4812001:Dnajc14 UTSW 10 128806683 missense probably damaging 0.96
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R1932:Dnajc14 UTSW 10 128816792 missense probably damaging 1.00
R4412:Dnajc14 UTSW 10 128806205 start gained probably benign
R4717:Dnajc14 UTSW 10 128806244 missense possibly damaging 0.92
R4804:Dnajc14 UTSW 10 128814057 missense probably benign 0.06
R4870:Dnajc14 UTSW 10 128817350 missense probably benign 0.00
R6323:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6325:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6400:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6452:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6453:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6556:Dnajc14 UTSW 10 128814631 missense probably benign 0.42
R6847:Dnajc14 UTSW 10 128816787 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGACCGCTTGGCTGTTCTC -3'
(R):5'- CCCTTGACTCTACACTCCCTAAA -3'

Sequencing Primer
(F):5'- CGCTTGGCTGTTCTCTTGGC -3'
(R):5'- TTGACTCTACACTCCCTAAAAACTGG -3'
Posted On2018-05-04