Incidental Mutation 'R6399:Serpinb9g'
ID516107
Institutional Source Beutler Lab
Gene Symbol Serpinb9g
Ensembl Gene ENSMUSG00000057726
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9g
Synonyms1600002F03Rik, NK21B, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R6399 (G1)
Quality Score159.009
Status Not validated
Chromosome13
Chromosomal Location33484790-33496004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33492851 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 205 (L205F)
Ref Sequence ENSEMBL: ENSMUSP00000080597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081927]
Predicted Effect probably benign
Transcript: ENSMUST00000081927
AA Change: L205F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080597
Gene: ENSMUSG00000057726
AA Change: L205F

DomainStartEndE-ValueType
SERPIN 13 377 2.87e-166 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 97% (28/29)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,647,559 C569R probably damaging Het
Acadsb T A 7: 131,430,055 W207R probably damaging Het
Apbb2 C T 5: 66,451,467 probably null Het
Atad2b T C 12: 4,957,558 V415A probably damaging Het
Ccdc150 G A 1: 54,263,957 probably null Het
Chd7 A G 4: 8,828,274 T1072A probably damaging Het
Depdc1b T A 13: 108,324,046 F63L probably damaging Het
Dnah2 C T 11: 69,458,518 V2431M probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Flnc A G 6: 29,458,883 E2421G probably damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Kcna4 T C 2: 107,296,549 S543P probably damaging Het
Lrrc30 T A 17: 67,632,686 probably benign Het
Msh6 T A 17: 87,986,891 S1025T probably damaging Het
Ndrg3 C G 2: 156,940,374 A191P probably damaging Het
Olfr259 C T 2: 87,107,986 V134I probably benign Het
Olfr467 A G 7: 107,814,754 T57A possibly damaging Het
Olfr99 T C 17: 37,279,775 Y215C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rnf34 T C 5: 122,861,776 F32L probably benign Het
Tbc1d24 T A 17: 24,208,329 I220F probably damaging Het
Thsd7b A T 1: 129,816,648 T758S probably benign Het
Trak1 A G 9: 121,453,496 probably null Het
Ttn T G 2: 76,726,062 S30200R probably damaging Het
Ttn G C 2: 76,726,063 F30199L probably benign Het
Uggt1 T C 1: 36,163,366 D1050G possibly damaging Het
Veph1 T A 3: 66,125,891 S605C probably benign Het
Wbp1 A G 6: 83,120,001 probably benign Het
Ythdc2 C A 18: 44,886,402 Q1413K possibly damaging Het
Other mutations in Serpinb9g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Serpinb9g APN 13 33495105 nonsense probably null
IGL02346:Serpinb9g APN 13 33486531 start codon destroyed probably benign 0.12
IGL02665:Serpinb9g APN 13 33495103 missense possibly damaging 0.54
IGL02936:Serpinb9g APN 13 33494882 missense possibly damaging 0.94
R1611:Serpinb9g UTSW 13 33492874 missense possibly damaging 0.46
R3873:Serpinb9g UTSW 13 33486535 missense probably benign 0.45
R4060:Serpinb9g UTSW 13 33495106 missense probably benign 0.19
R4505:Serpinb9g UTSW 13 33486563 missense probably damaging 1.00
R6843:Serpinb9g UTSW 13 33492917 missense probably damaging 1.00
R6844:Serpinb9g UTSW 13 33486633 missense probably damaging 0.99
R6942:Serpinb9g UTSW 13 33494905 missense probably benign 0.03
R7319:Serpinb9g UTSW 13 33488560 nonsense probably null
R7466:Serpinb9g UTSW 13 33495167 missense probably benign
R7470:Serpinb9g UTSW 13 33486634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGGAATTGTACCTGGAACATG -3'
(R):5'- TCCCTCAAATGGCAGTTGC -3'

Sequencing Primer
(F):5'- ACCTGGAACATGAATATTGATTTCAC -3'
(R):5'- GGACACAAATGAACACTGGATTCTTC -3'
Posted On2018-05-04